20‐Hydroxyecdysone‐upregulated proteases involved in Bombyx larval fat body destruction

Abstract

During insect larval-pupal metamorphosis, the obsolete larval organs and tissues undergo histolysis and programmed cell death to recycle cellular materials. It has been demonstrated that some cathepsins are essential for histolysis in larval tissues, but the process of tissue destruction is not well documented. Fat body, the homologous organ to mammalian liver and adipose tissue, goes through a distinct destruction process during larval-pupal transition. Herein, we found that most of the Bombyx proteases - including Bombyx cathepsin B (BmCatB) (BmCatLL-2), Bombyx cathepsin D (BmCatD), Bombyx cathepsin L like-1 (BmCatLL-1) and -2(BmCatLL-2), Bombyx fibroinase (BmBcp), Bombyx matrix metalloprotease (BmMmp), Bombyx A disintegrin and metalloproteinase with thrombospondin motifs 1 (BmAdamTS-1), Bombyx A disintegrin and metalloproteinase with thrombospondin motifs like (BmAdamTS L) and Bombyx cysteine protease inhibitor (Bmbcpi)- were expressed highly in fat body during feeding and metamorphosis, with a peak occurring during the nonfeeding moulting or prepupal stage, as well as being responsive to 20-hydroxyecdysone (20E). The aforementioned protease genes expression was upregulated by injection of 20E into the feeding larvae, while blocking 20E signalling transduction led to downregulation. Western blotting and immunofluorescent staining of BmCatB and BmBcp confirmed the coincident variation of their messenger RNA (mRNA) and protein level during the development and after the treatments. Moreover, BmCatB, BmBcp, BmMmp and BmAdamTS-1 RNA interference all led to blockage of larval fat body destruction. Taken together, we conclude that 20E regulates larval fat body destruction by upregulating related protease gene expression and protein levels during larval-pupal transition.

Tip60 Phosphorylation at Ser 99 Is Essential for Autophagy Induction in Bombyx mori

“…During larval-pupal metamorphosis, several larval tissues undergo intensive histolysis and programmed cell death [5,37]. In order to reveal the function of BmTip60, its tissue distribution was Using the antibody against pan-acetylation, the acetylation levels of total proteins were detected in the B. mori fat body at day 4 of 5 larval instar (5L4D, middle of the last feeding larval stage), day 7 of 5 larval instar (5L7D, the last day of feeding larval stage), Wandering (W, spinning), and PP2 (day 2 of prepupa) stages.…”

Clathrin‐dependent endocytosis predominantly mediates protein absorption by fat body from the hemolymph in Bombyx mori

“…During larval–pupal metamorphosis, the larval fat body undergoes a series of physiological events to meet the requirements of metamorphosis and maintain intracellular homeostasis (Tian et al ., ; Guo et al ., ; Li et al ., ). Hexamerins and phenoloxidases both belong to the hemocyanin protein superfamily; however, these two subtype have distinct functions and display controversial interactions under specific conditions (Rhee et al ., ; Wang et al ., ).…”

“…The B. mori (Dazao) provided by the Sericultural and Agri‐Food Research Institute of the Guangdong Academy of Agricultural Sciences (Guangzhou, China), were reared on fresh mulberry leaves in the laboratory at 25 °C under 14 h light : 10 h dark cycles (Guo et al ., ).…”

“…The template for double‐stranded RNA (dsRNA) synthesis was amplified by polymerase chain reaction from fat body in B. mori , and the dsRNA of egfp (F: GGATCCTAATACGACTCACTATAGGGAGAATGGTGAGCAAGGGCG; R: GGATCCTAATACGACTCACTATAGGGAGACTTGTACAGCTCGTCC) and Bmcalthrin (F: GGATCCTAATACGACTCACTATAGGGAAGTGACGGTAGAGGAAGAC; R: GGATCCTAATACGACTCACTATAGGGAGTTGGCACGAAGGTAAA) were generated using the T7 RiboMAX TM Express RNAi system (Promega, P1700, Madison, WI, USA) according to the manufacturer's instructions. Each individual larva was injected with dsRNA of Bmcalthrin (30 μ g) at 12 h before initiation of wandering, and egfp dsRNA (30 μ g) was injected as a control (Tian et al ., ; Guo et al ., ).…”

Proteolytic profile of larval developmental stages of Penaeus vannamei: An activity and mRNA expression approach

“…In the particular cases of peptidase gene expression during metamorphosis, this is a process highly controlled by hormonal changes in both insects and crustaceans [70,71]. Some peptidases are classified as ecdysteroid-responsive genes, since they are known to contain ecdysone response elements in their promoters [72], and are under the control of the ecdysone cassette [73,74]. At the protein level, molt has also been described to be controlled by peptidase inhibitors, and these molecules are considered regulators of the molting process [35].…”