59 Histone Deacetylase 1 Knock-Down in Bovine Fibroblast Cells and Cloned Embryos

Abstract

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P < 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P > 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P < 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.