The non-relativistic energies of ls%p (n = 2, 3, 4 and 5 ) states for the lithium isoelectronic sequence from Li I to Ne VI11 are calculated using the full-core plus correlation method. Relativistic and mass polarization effects on the energy are evaluated using first order perturbation theory. The fine structures are determined from the expectation values of the spin-orbit and spin-other-orbit interaction operators in the Pauli-Breit approximation. The higher order relativistic effects are estimated using the hydrogenic solution to the Dirac equation with an effective nuclear charge. The QED correction is also included. Our results are compared with the experimental and theoretical data in the literature. The fine structure results agree well with experiment. For ls%p energies with n 2 3, it appears that our results are quite accurate for all Z investigated. However, for the ls22p systems, the discrepancy with experiment grows monotonically from 0.5cm-' for Li I to 29cm-' for Ne VIII. This is very different from all the other ls'nl systems we have investigated using the same method. What separates ls22p apart from the others is the unusually large orbit-orbit interaction and mass polarization effects. For Z > 6, the expectation values of these perturbation operators are opposite in sign to those of the 1s' core. This energy increases quickly with Z.

Abstract.The basic structure parameters of 2p4(3p)ns and 2p4(3p)nd (J = 1/2, 3/2 and 5/2) Rydberg spectra for the fluorine isoelectronic sequence from FI to NiXX, as functions of effective nuclear charge, are calculated by using the eigenchannel quantum-defect theory. The results can be interpreted in terms of the variations of electrostatic and spin-orbit interactions along the sequence. A vast amount of basic atomic data can be obtained with these parameters as input. Some numerical examples are given, in which our results are in perfect agreement with experimental.

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P < 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P > 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P < 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.

Cryopreservation of oocytes and embryos is very useful to conservation of animal genetic resources. Recently, parthenogenesis has received considerable attention as a tool for the production of stem cells. Oocytes and embryos undergo considerable morphological changes and functional damage during cryopreservation, and the survival rate is highly depending on species and developmental stage of oocytes and embryos. The aim of this study was to investigate the survival rate and embryonic quality of bovine parthenogenetic blastocysts post-vitrification cryopreservation. Cumulus-oocyte complexes (COC) from slaughterhouse ovaries were aspirated from 2-mm to 8-mm visible follicles with a 5-mL syringe. The COC were matured in vitro for 22 h in bicarbonate-buffered TCM199 media supplemented with 1 mg mL-1 of FSH, 10 mg mL-1 of LH, 1 mg mL-1 of 17-βiestradiol, and 10% FBS. After in vitro maturation, cumulus cells were removed from COC, oocytes with first polar body were activated by 5 μM ionomycin for 5 min and 2 mM 6-DMAP for 4 h. Subsequently, oocytes were co-cultured with bovine fetal fibroblast cells in SOF media supplemented with amino acids (1% NEAA and 2% EAA), 4 mg mL-1 of BSA, and 10% FBS at conditions of 38.5°C and 5% CO2 for 7 to 9 days. The good expanded blastocysts were selected and refrigerated in different vectors [glass micropipettes (GMP) and straws] and same vitrification solution (VS, 20% EG + 20% DMSO). Blastocysts were exposed to VS, loaded on vectors, and plunged into liquid nitrogen within 25 s. After two days refrigeration, vitrified blastocysts were thawed in air for 10 s and placed into 0.25 M sucrose solution for 1 min and 0.15 M sucrose solution for 5 min. Then, the blastocysts were cultured in the SOF medium same as above. Our results showed that when VS was 20% EG + 20% DMSO, the hatching rate (65%) of blastocysts loaded into GMP was significantly higher (P < 0.05) than that (19%) of blastocysts loaded into straws post-vitrification. Meanwhile, vitrified and nonvitrified blastocysts were fixed and stained for differential cell counting as described by Thouas GA et al. 2001 Reprod. Biomed. Online 3, 25-29). By the differential staining, the total cells of nonvitrified parthenogenetic bovine blastocysts were 102.7, which was higher (P > 0.05) than that (86.7) of vitrified blastocysts. Also, no significant difference (P > 0.05) was seen on ratios between vitrified blastocysts (ICM/TE = 0.22) and nonvitrified blastocysts (ICM/TE = 0.25). Our results indicated that a glass micropipette vector was much better than a straw in vitrification cryopreservation of bovine parthenogenetic blastocysts and caused less damage to blastocyst cells. This study lays the foundation for further research to increase the survival rate of vitrification cryopreservation of bovine embryos. This work was supported by the grant from national support plan, China, No. 2007BAD55B03; corresponding author: Ziyi Li.