7.7 Genetic Manipulation of Enteric Campylobacter Species

Vliet, Arnoud H. M. van; Wood, Anne C.; Wooldridge, Karl G.; Ketley, Julian M.; Henderson, John

doi:10.1016/s0580-9517(08)70301-5

Cited by 74 publications

(90 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Because the insertion is such that the cassette promoter maintains downstream expression, lysS and its downstream gene (glyA) are expressed in this construct. It has not been possible to construct on the chromosome an insertion that is oriented in the opposite direction (36), but the present data strongly suggest that derepressed expression of Fur-regulated genes abrogates nitrosative stress.…”

mentioning

confidence: 55%

Oxygen- and NssR-dependent Globin Expression and Enhanced Iron Acquisition in the Response of Campylobacter to Nitrosative Stress

Monk

Pearson

Mulholland

et al. 2008

Journal of Biological Chemistry

View full text Add to dashboard Cite

Pathogenic bacteria experience nitrosative stress from NO generated in the host and from nitrosating species such as S-nitrosoglutathione. The food-borne pathogen Campylobacter jejuni responds by activating gene expression from a small regulon under the control of the NO-sensitive regulator, NssR. Here, we describe the full extent of the S-nitrosoglutathione response using transcriptomic and proteomic analysis of batch-and chemostat-cultured C. jejuni. In addition to the NssR regulon, which includes two hemoglobins (Cgb and Ctb), we identify more than 90 other up-regulated genes, notably those encoding heat shock proteins and proteins involved in oxidative stress tolerance and iron metabolism/transport. Up-regulation of a subset of these genes, including cgb, is also elicited by NO-releasing compounds. Mutation of the iron-responsive regulator Fur results in insensitivity of growth to NO, suggesting that derepression of iron-regulated genes and augmentation of iron acquisition is a physiological response to nitrosative damage. We describe the effect of oxygen availability on nitrosative stress tolerance; cells cultured at higher rates of oxygen diffusion have elevated levels of hemoglobins, are more resistant to inhibition by NO of both growth and respiration, and consume NO more rapidly. The oxygen response is mediated by NssR. Thus, in addition to NO detoxification catalyzed by the hemoglobins Cgb and possibly Ctb, C. jejuni mounts an extensive stress response. We suggest that inhibition of respiration by NO may increase availability of oxygen for Cgb synthesis and function.

show abstract

mentioning

confidence: 55%

Oxygen- and NssR-dependent Globin Expression and Enhanced Iron Acquisition in the Response of Campylobacter to Nitrosative Stress

Monk

Pearson

Mulholland

et al. 2008

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…The disrupted genes were re-amplified using primers Cj1294P1 (AGGGTACATC-TCCATGCTTACTTATTCTCATCA) and Cj1294P2 (GCGT-CGGATCCTTATCCACAATATCCCTTTTT) and Cj1121cP1 (CGGGATCCATGAGATTTTTTCTTTCTCC) and Cj1121cP2 (GAAGATCTTAAGCCTTTATGCTCTTTA), cut with AflIII and BamHIII for cj1294 and BglII and BamHIII for cj1121c, and ligated to C. jejuni chromosomal DNA that had been cut with the same enzymes. The DNA was introduced into C. jejuni by natural transformation with 0.03% saponin using the biphasic method (9,34). After selection on 20 g/ml chloramphenicol, candidate mutants were checked by PCR and Southern blotting.…”

Section: Methodsmentioning

confidence: 99%

Cj1121c, a Novel UDP-4-keto-6-deoxy-GlcNAc C-4 Aminotransferase Essential for Protein Glycosylation and Virulence in Campylobacter jejuni

Somalinga

Merkx-Jacques

Ratnayake

et al. 2006

Journal of Biological Chemistry

View full text Add to dashboard Cite

Campylobacter jejuni produces glycoproteins that are essential for virulence. These glycoproteins carry diacetamidobacillosamine (DAB), a sugar that is not found in humans. Hence, the enzymes responsible for DAB synthesis represent potential therapeutic targets. We describe the biochemical characterization of Cj1121c, a putative aminotransferase encoded by the general protein glycosylation locus, to assess its role in DAB biosynthesis. By using overexpressed and affinity-purified enzyme, we demonstrate that Cj1121c has pyridoxal phosphate-and glutamate-dependent UDP-4-keto-6-deoxy-GlcNAc C-4 transaminase activity and produces UDP-4-amino-4,6-dideoxy-GlcNAc. This is consistent with a role in DAB biosynthesis and distinguishes Cj1121c from Cj1294, a homologous UDP-2-acetamido-2,6-dideoxy-␤-L-arabino-4-hexulose C-4 aminotransferase that we characterized previously. We show that Cj1121c can also use this 4-keto-arabino sugar indirectly as a substrate, that Cj1121c and Cj1294 are active simultaneously in C. jejuni, and that the activity of Cj1121c is preponderant under standard growth conditions. Kinetic data indicate that Cj1121c has a slightly higher catalytic efficiency than Cj1294 with regard to the 4-keto-arabino substrate. By site-directed mutagenesis, we show that residues Glu-158 and Leu-131 are not essential for catalysis or for substrate specificity contrary to expectations. We further demonstrate that a cj1121c knock-out mutant is impaired for flagella-mediated motility, for invasion of intestinal epithelial cells, and for persistence in the chicken intestine, clearly demonstrating that Cj1121c is essential for host colonization and virulence. Finally, we show that cj1121c is necessary for protein glycosylation by lectin Western blotting. Collectively, these results validate Cj1121c as a promising drug target and provide the means to assay for inhibitors.

show abstract

“…Antibiotics were used at the following final concentrations : 10 µg vancomycin ml -", 50 µg kanamycin ml − ", and 20 µg chloramphenicol ml − ", when appropriate. Ironrestricted growth conditions were achieved by supplementing MH medium with Desferal (Sigma) to a final concentration of 20 µM (van Vliet et al, 1998b). For motility tests, C. jejuni grown overnight in MH broth at 37 mC under microaerobic conditions was diluted in MH broth to approximately 100 cells ml − ", and, subsequently, 100 µl of this cell suspension was added to 5 ml soft agar [MH broth containing 0n3% (w\v) agar, cooled to 45 mC], poured onto soft agar plates [MH broth containing 0n4% (w\v) agar], and incubated for 2 days microaerobically at 37 mC.…”

Section: Methodsmentioning

confidence: 99%

“…A PCR was performed using Vent polymerase (New England Biolabs) or Taq polymerase (Life Technology) according to the manufacturer's instructions. Allelic exchange mutagenesis of flhB was performed by insertion of the chloramphenicol-resistance (cat) cassette of plasmid pAV35 (van Vliet et al, 1998b) in both transcriptional orientations into the unique BclI restriction site of the flhB gene (Fig. 1).…”

Section: Methodsmentioning

confidence: 99%

“…C. jejuni wild-type and flhB mutants were grown on MH agar for 24 h, fractionated into periplasmic, cytoplasmic and membrane-bound proteins (van Vliet et al, 1998b) and subjected to SDS-PAGE (Sambrook et al, 1989). Gels were either stained with PAGE blue 83 (Fluka) or immunoblotted and subsequently incubated with mouse monoclonal antibodies P3B2 and O2D4, which recognize both Campylobacter flagellin A and flagellin B (Constantinidou et al, 1996 ;Jagannathan et al, 2001).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Mutational and transcriptional analysis of the Campylobacter jejuni flagellar biosynthesis gene flhB

et al. 2002

Self Cite

View full text Add to dashboard Cite

7.7 Genetic Manipulation of Enteric Campylobacter Species

Cited by 74 publications

References 33 publications

Oxygen- and NssR-dependent Globin Expression and Enhanced Iron Acquisition in the Response of Campylobacter to Nitrosative Stress

Oxygen- and NssR-dependent Globin Expression and Enhanced Iron Acquisition in the Response of Campylobacter to Nitrosative Stress

Cj1121c, a Novel UDP-4-keto-6-deoxy-GlcNAc C-4 Aminotransferase Essential for Protein Glycosylation and Virulence in Campylobacter jejuni

Mutational and transcriptional analysis of the Campylobacter jejuni flagellar biosynthesis gene flhB

Contact Info

Product

Resources

About