A Comparison of Two Methods for Screening CEBPA Mutations in Patients with Acute Myeloid Leukemia

Abstract

The goal of the study was to compare the performance of a fluorescence-based multiplex PCR fragment analysis to a direct sequencing method for detecting CEBPA mutations in patients with acute myeloid leukemia. Thirty-three samples were selected from a larger study of 107 cases of acute myeloid leukemia by screening for CEBPA mutations by sequence analysis. Of ten identified mutations , six (insertions and deletions) were detected by both sequencing and fragment methods. The fragment analysis method did not detect the remaining four base substitutions because the method cannot detect changes that result in identically sized products. The multiplex PCR fragment length analysis method therefore failed to detect substitution mutations accounting for 40% of total CEBPA mutations in our patient set. Our results indicate that fragment length analysis should not be used in isolation , and that direct sequencing is required to evaluate CEBPA gene mutational status in acute myeloid leukemia. A combination of the two assays may offer some advantages , chiefly in permitting more sensitive detection by fragment length analysis of insertions and deletions. CEBPA encodes a protein exclusively expressed in the myelomonocytic lineage. It is important for commitment to the granulocytic lineage and for differentiation of mature neutrophils. 1 The ability of CEBPA to induce granulocytic differentiation is enhanced by RAS-dependent phosphorylation of serine 248 of the CEBPA transactivation domain. 2 Leukemia-associated CEBPA gene mutations can be divided into two groups. One group of mutations consists of in-frame insertions in the basic/ leucine zipper (bZIP) region that contains DNA-binding as well as dimerization domains. The other group of mutations consists of truncating out-of-frame insertions or deletions in the N-terminus, resulting in premature termination of the normal 42-kDa protein. 3 Most of the frameshifting N-terminal mutations cause enhanced translation of a dominant-negative 30-kDa protein, which may be responsible for the differentiation block observed in acute myeloid leukemias expressing this protein. 3 Mutations in the CEBPA gene are among the most common mutations in AML, particularly in patients with French-American-British (FAB) subtypes M1 and M2. 4 -6 The majority of leukemias with CEBPA mutations have a normal karyotype. 7,8 Several studies of the prognostic significance of CEBPA mutations in patients with acute myeloid leukemia (AML) have shown that the presence of a CEBPA mutation is associated with significantly increased event-free survival, overall survival, and remission duration. 2,6,7 In addition, sequential analysis of CEBPA mutations revealed that the same mutation was present at diagnosis and relapse, but not in complete remission. 4,9 Accurate testing for CEBPA mutations is important for identification of this prognostically significant AML subtype. AML with mutated CEBPA is a provisional disease entity in the 2008 World Health Organization classification of leukemias. 10 Many prior studies h...

Prevalence and Prognostic Impact of CEBPA Gene Mutation (Simplified Assay Technique) in Egyptian Acute Myeloid Leukemia Patients with Normal Cytogenetics

“…However, there was no significant difference in FAB classification between CEBPA mutated and wild groups. The prevalence of M2 in CEBPA mutated AML was agreed by most of the previous studies [14,23,24,25]. However, others reported M1 as the mostly occurring FAB subtypes in CEBPA mutated AML [17,26,27].…”

“…51104, USA) according to the manufacturer's protocol. To amplify CEBPA gene, 3 pairs of primers were used; TAD1F (HEX):5 0 TCGGCCGACTTCTA CGAGGC3 0 , TAD1R: 5 0 GCGCCCGGGTAGTCAAAGT3 0 ,T AD2F(NED):5 0 TACCTGGACGGCAGGCTGGA3 0 ,TAD2R: 5 0 TGCAGGTGCATGGTGGTCT3 0 ,bZIPF(FAM):5 0 AGAAG TCGGTGGACAAGAACA3 0 ,bZIPR: 5 0 AGTTGCCCATGGC CTTGAC3 0 , that cover the entire coding region of human CEBPA gene were used [14]. The forward primers in each pair were fluorescently labeled to enable post PCR fragment analysis using Gene Mapper analysis (Applied Biosystems, Foster City, CA, USA).…”

Strategy for Robust Detection of Insertions, Deletions, and Point Mutations in CEBPA, a GC-Rich Content Gene, Using 454 Next-Generation Deep-Sequencing Technology

“…Fragment length analysis cannot detect base substitutions, and therefore it would not be technically possible to detect eight of 35 mutations (23%) as observed in our cohort. Moreover, DHPLC analyses can miss rare mutations (eg, if these are located at the very end of the respective 10 but has a currently accepted lower cut-off value of 20% diagnostic sensitivity.…”

“…8,9 Today, the screening of CEBPA mutations in patients with AML is often performed applying a combination of fragment length analysis, DH-PLC, and subsequent direct Sanger sequencing. 10,11 The 454 deep-pyrosequencing method includes emulsion PCR (emPCR) steps that allow a direct, massively parallel clonal amplification of PCR products. In principle, amplicon sequencing allows for a highly sensitive detection of molecular mutations.…”

Integration of Technical, Bioinformatic, and Variant Assessment Approaches in the Validation of a Targeted Next-Generation Sequencing Panel for Myeloid Malignancies

“…We therefore determined that use of NGS for CEBPA assessment needs to be supplemented with Sanger sequencing, using a modification to previously published primer sets. 29 Analysis of Variants in the ASXL1 Homopolymer Region (ASXL1 c.1934dupG; p.Gly646fs).-The ASXL1 c.1934dupG variant occurs in a homopolymer run of 8 G nucleotides, and its clinical relevance is controversial in the literature. 30 This variant has been reported to occur as a PCR artifact resulting from polymerase slippage.…”