A DNA Barcoding Method to Discriminate between the Model Plant Brachypodium distachyon and Its Close Relatives B. stacei and B. hybridum (Poaceae)

Abstract

Background Brachypodium distachyon s. l. has been widely investigated across the world as a model plant for temperate cereals and biofuel grasses. However, this annual plant shows three cytotypes that have been recently recognized as three independent species, the diploids B. distachyon (2n = 10) and B. stacei (2n = 20) and their derived allotetraploid B. hybridum (2n = 30).Methodology/Principal FindingsWe propose a DNA barcoding approach that consists of a rapid, accurate and automatable species identification method using the standard DNA sequences of complementary plastid (trnLF) and nuclear (ITS, GI) loci. The highly homogenous but largely divergent B. distachyon and B. stacei diploids could be easily distinguished (100% identification success) using direct trnLF (2.4%), ITS (5.5%) or GI (3.8%) sequence divergence. By contrast, B. hybridum could only be unambiguously identified through the use of combined trnLF+ITS sequences (90% of identification success) or by cloned GI sequences (96.7%) that showed 5.4% (ITS) and 4% (GI) rate divergence between the two parental sequences found in the allopolyploid.Conclusion/SignificanceOur data provide an unbiased and effective barcode to differentiate these three closely-related species from one another. This procedure overcomes the taxonomic uncertainty generated from methods based on morphology or flow cytometry identifications that have resulted in some misclassifications of the model plant and its allies. Our study also demonstrates that the allotetraploid B. hybridum has resulted from bi-directional crosses of B. distachyon and B. stacei plants acting either as maternal or paternal parents.

Recreating Stable Brachypodium hybridum Allotetraploids by Uniting the Divergent Genomes of B. distachyon and B. stacei

“…distachyon and B . stacei is now clearly elucidated [26, 32–34, 69]. The creation of synthetic allotetraploid plants similar to natural B .…”

“…distachyon and B . stacei as the maternal parent [34]. In our experiments, all surviving synthetic allotetraploids had B .…”

“…stacei (and by corollary the sub-genomes of B . hybridum ) are quite divergent in terms of sequence and chromosome number [31–34]. Further supporting this system, the genomes of all three species have been sequenced: the B .…”

Population Structure in the Model Grass Brachypodium distachyon Is Highly Correlated with Flowering Differences across Broad Geographic Areas

“…Polymerase chain reaction primers flanking a trnL‐trnF intergenic region diagnostic for Brachypodium species identification (López‐Alvarez et al, 2012) were used to amplify part of the plastid trnLF locus from the same DNA samples that were sent for GBS. As previously described (Taberlet et al, 1991; López‐Alvarez et al, 2012), ‘c’ (5′ CGAAATCGGTAGACGCTACG 3′) and ‘f’ (5′ ATTTGAACTGGTGACACGAG 3′) universal primers were used for PCR. Amplification was performed with ExTaq DNA polymerase (Clontech) under the following conditions: 98°C for 30 s; 35 cycles of 98°C for 10 s, 53°C for 30 s, 72°C for 1 min; and 72°C for 10 min.…”

Phenology and polyploidy in annualBrachypodiumspecies (Poaceae) along the aridity gradient in Israel

“…are self–fertile grasses (Vogel et al, ) comprised of three different species; B. distachyon, B. stacei and B. hybridum . Each of these three species is a different karyotype (López‐Alvarez et al, ; López‐Alvarez et al, ): the two species, B. distachyon (2 n = 10, 0.631 pg/2C) and B. stacei (2 n = 20, 0.564 pg/2C) are diploid species with relatively small genomes, while B. hybridum (2 n = 30, 1.265 pg/2C) is a derived allotetraploid with a larger genome size (Catalán et al, ). These species share similar DNA content, differing only in the number of chromosomes due to multiple centric fusion/fission events (Catalán et al, ).…”