A Highly Conserved Residue in HIV-1 Nef Alpha Helix 2 Modulates Protein Expression

Johnson, Aaron L.; Dirk, Brennan S.; Coutu, Mathieu; Haeryfar, S. M. Mansour; Arts, Eric J.; Finzi, Andrés; Dikeakos, Jimmy D.

doi:10.1128/msphere.00288-16

Cited by 13 publications

(20 citation statements)

References 59 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Flow cytometry analysis indicated that the Nef proteins from HIV-1 reference strains C (BR.92025), G (F1.93.HH8793), and H (BE.93.VI997) displayed a marked reduction in the ability to downregulate both MHC-I and CD4 from the cell surface, compared to the efficiency observed with Nef isolated from the laboratory strain NL4.3 ( Figure 1 B,C). The decreased ability of C (BR.92025) to downregulate MHC-I and CD4 is consistent with our previous report [ 33 ]. Alternatively, the Nef proteins of reference from subtypes A1, B, D, F2, J, and K display a similar ability to downregulate MHC-I when compared to NL4.3, while Nef proteins of reference from subtypes A1, A2, B, D, F1, F2, J, and K display a similar ability to downregulate CD4 when compared to NL4.3 ( Figure 1 B,C).…”

Section: Resultssupporting

confidence: 93%

“…Pseudovirions were produced in HEK 293T cells via a triple transfection with pNL4.3 Δgag/pol enhanced GFP (eGFP), pdR8.2 (Addgene; catalog number 12263), and pMD2.G (Addgene; catalog number 12259) plasmids, using PolyJet (FroggaBio, Toronto, ON, Canada), as previously reported [ 32 ]. Different eGFP-tagged or untagged Nef proteins were subcloned into the pNL4.3 Δgag/pol eGFP proviral backbone as previously described [ 32 , 33 ] using an AgeI/NotI restriction digest. The pseudovirus was collected 48 h post transfection, with virus-containing media centrifuged at 3000× g for 5 min and subsequently filtered with a 0.2-μm filter.…”

Section: Methodsmentioning

confidence: 99%

“…MHC-I downregulation efficiency (%NL4.3 = (MFI exp − MFI dNef /MFI NL4. − MFI dNef ) × 100%), and CD4 downregulation efficiency (%NL4.3 = (MFI exp − MFI egfp /MFI NL4.3 − MFI dNef ) × 100%) were calculated as previously described [ 33 ]. Downregulation efficiency is relative to NL4.3.…”

Section: Methodsmentioning

confidence: 99%

“…Jurkat E6.1 cells were infected with lentiviral vectors [ 33 ] encoding Nef NL4.3 or Nef from subtype G (FI.93.HH8793) or H (BE.93.VI997) reference strains. Forty-eight hours post infection, RNA was collected with the PureLink ® RNA Mini Kit (Thermo Fisher Scientific).…”

Section: Methodsmentioning

confidence: 99%

“…The cDNA was used for qRT-PCR with a SensiFAST™ SYBR No-ROX Kit (FroggaBio) to amplify viral envelope protein (Env)-, Nef-, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH)-specific amplicons with the following primers: Env and Nef forward 5′–GGCGGCGACTGAAGAAG, Env reverse 5′–ACTATGGACCACACAACTATTGCT, Nef reverse 5′–GATTGGGAGGTGGGTTGCT, GAPDH forward 5′–ACAACTTTGGTATCGTGGAAGG, and GAPDH reverse 3′–GCCATCACGCCACAGTTTC. The qRT-PCR runs were performed on a Rotor-Gene 6000 (Qiagen, Valencia, CA, USA) as previously described [ 33 ]. The relative levels of Nef, Env, and GAPDH mRNA were calculated from standard curves generated from linearized plasmids encoding the respective genes at known concentrations.…”

Section: Methodsmentioning

confidence: 99%

See 4 more Smart Citations

Identification of Novel Subcellular Localization and Trafficking of HIV-1 Nef Variants from Reference Strains G (F1.93.HH8793) and H (BE.93.VI997)

Nynatten

Johnson

Dirk

et al. 2018

Viruses

View full text Add to dashboard Cite

The human immunodeficiency virus type 1 (HIV-1) accessory protein Nef, plays an essential role in disease progression and pathogenesis via hijacking the host cellular membrane-trafficking machinery. Interestingly, HIV-1 group-M subtypes display differences in the rate of disease progression. However, few reports investigated how the cellular behaviors and activities of Nef isolates from reference strains may differ between HIV-1 group-M subtypes. Here, we characterize how differing cellular distributions of Nef proteins across group-M subtypes may impact protein function using immunofluorescence microscopy and flow cytometric analysis. We demonstrate that Nef variants isolated from HIV-1 group-M subtypes display differences in expression, with low expressing Nef proteins from reference strains of subtypes G (F1.93.HH8793) and H (BE.93.VI997) also displaying decreased functionality. Additionally, we demonstrate variations in the subcellular distribution and localization of these Nef proteins. Nef from subtype G (F1.93.HH8793) and H (BE.93.VI997) reference strains also failed to colocalize with the trans-Golgi network, and were not differentially localized to cellular markers of multivesicular bodies or lysosomes. Strikingly, our results demonstrate that HIV-1 Nef proteins from reference strains G (F1.93.HH8793) and H (BE.93.VI997) highly colocalize with labeled mitochondrial compartments.

show abstract

Section: Resultssupporting

confidence: 93%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 3 more Smart Citations

Identification of Novel Subcellular Localization and Trafficking of HIV-1 Nef Variants from Reference Strains G (F1.93.HH8793) and H (BE.93.VI997)

Nynatten

Johnson

Dirk

et al. 2018

Viruses

View full text Add to dashboard Cite

show abstract

Consequences of HLA‐associated mutations in HIV‐1 subtype C Nef on HLA‐I downregulation ability

Mann

Rajkoomar

Jin

et al. 2020

Journal of Medical Virology

View full text Add to dashboard Cite

Identification of CD8+ T lymphocyte (CTL) escape mutations that compromise the pathogenic functions of the Nef protein may be relevant for an HIV-1 attenuation-based vaccine. Previously, HLA-associated mutations 102H, 105R, 108D, and 199Y were individually statistically associated with decreased Nef-mediated HLA-I downregulation ability in a cohort of 298 HIV-1 subtype C infected individuals. In the present study, these mutations were introduced by site-directed mutagenesis into different patient-derived Nef sequence backgrounds of high similarity to the consensus C Nef sequence, and their ability to downregulate HLA-I was measured by flow cytometry in a CEM-derived T cell line. A substantial negative effect of 199Y on HLA-I downregulation and Nef expression was observed, while 102H and 105R displayed negative effects on HLA-I downregulation ability and Nef expression to a lesser extent. The total magnitude of CTL responses in individuals harboring the 199Y mutation was lower than those without the mutation, although this was not statistically significant. Overall, a modest positive relationship between Nef-mediated HLA-I downregulation ability and total magnitude of CTL responses was observed, suggesting that there is a higher requirement for HLA-I downregulation with increased CTL pressure. These results highlight a region of Nef that could be targeted by vaccine-induced CTL to reduce HLA-I downregulation and maximize CTL efficacy.

show abstract

Myosin-X is essential to the intercellular spread of HIV-1 Nef through tunneling nanotubes

Uhl

Gujarathi

Waheed

et al. 2018

J. Cell Commun. Signal.

View full text Add to dashboard Cite

Tunneling nanotubes (TNTs) are intercellular structures that allow for the passage of vesicles, organelles, genomic material, pathogenic proteins and pathogens. The unconventional actin molecular motor protein Myosin-X (Myo10) is a known inducer of TNTs in neuronal cells, yet its role in other cell types has not been examined. The Nef HIV-1 accessory protein is critical for HIV-1 pathogenesis and can self-disseminate in culture via TNTs. Understanding its intercellular spreading mechanism could reveal ways to control its damaging effects during HIV-1 infection. Our goal in this study was to characterize the intercellular transport mechanism of Nef from macrophages to T cells. We demonstrate that Nef increases TNTs in a Myo10-dependent manner in macrophages and observed the transfer of Nef via TNTs from macrophages to T cells. To quantify this transfer mechanism, we established an indirect flow cytometry assay. Since Nef expression in T cells down-regulates the surface receptor CD4, we correlated the decrease in CD4 to the transfer of Nef between these cells. Thus, we co-cultured macrophages expressing varying levels of Nef with a T cell line expressing high levels of CD4 and quantified the changes in CD4 surface expression resulting from Nef transfer. We demonstrate that Nef transfer occurs via a cell-to-cell dependent mechanism that directly correlates with the presence of Myo10-dependent TNTs. Thus, we show that Nef can regulate Myo10 expression, thereby inducing TNT formation, resulting in its own transfer from macrophages to T cells. In addition, we demonstrate that up-regulation of Myo10 induced by Nef also occurs in human monocyte derived macrophages during HIV-1 infection.

show abstract

A Highly Conserved Residue in HIV-1 Nef Alpha Helix 2 Modulates Protein Expression

Cited by 13 publications

References 59 publications

Identification of Novel Subcellular Localization and Trafficking of HIV-1 Nef Variants from Reference Strains G (F1.93.HH8793) and H (BE.93.VI997)

Identification of Novel Subcellular Localization and Trafficking of HIV-1 Nef Variants from Reference Strains G (F1.93.HH8793) and H (BE.93.VI997)

Consequences of HLA‐associated mutations in HIV‐1 subtype C Nef on HLA‐I downregulation ability

Myosin-X is essential to the intercellular spread of HIV-1 Nef through tunneling nanotubes

Contact Info

Product

Resources

About