A Multifunctional Aqueous Channel Formed by CFTR

Abstract

The cystic fibrosis gene product (CFTR) is a complex protein that functions as an adenosine 3,5-monophosphate (cAMP)-stimulated ion channel and possibly as a regulator of intracellular processes. In order to determine whether the CFTR molecule contains a functional aqueous pathway, anion, water, and urea transport were measured in Xenopus oocytes expressing CFTR. Cyclic AMP agonists induced a Cl- conductance of 94 microsiemens and an increase in water permeability of 4 x 10(-4) centimeter per second that was inhibited by a Cl- channel blocker and was dependent on anion composition. CFTR has a calculated single channel water conductance of 9 x 10(-13) cubic centimeter per second, suggesting a pore-like aqueous pathway. Oocytes expressing CFTR also showed cAMP-stimulated transport of urea but not the larger solute sucrose. Thus CFTR contains a cAMP-stimulated aqueous pore that can transport anions, water, and small solutes. The results also provide functional evidence for water movement through an ion channel.

Expression and Distribution of Cystic Fibrosis Transmembrane Conductance Regulator in Neurons of the Human Brain

“…Expression of CFTR in epithelial cells has been reported previously Riordan et al 1989), and the function of CFTR in these cells has been extensively investigated and related to CF pathophysiology (Hasegawa et al 1992;Bradbury 1999;Mehta 2005). However, expression of CFTR in non-epithelial cells was reported only recently (Fonknechten et al 1992;Johannesson et al 1997;Di et al 2006;Painter et al 2006;Vandebrouck et al 2006), and this included expression of CFTR in neurons of the human hypothalamus (Mulberg et al 1995(Mulberg et al ,1998Weyler et al 1999).…”

“…A variety of intracellular functions have been attributed to CFTR, including regulation of membrane vesicle trafficking and fusion, acidification of organelles, and small anion transport (Bradbury et al 1992;Egan et al 1992;Hasegawa et al 1992;Lukacs et al 1992;Smith and Welsh 1992;Bradbury 1999;Chandy et al 2001). Recently, CFTR expression has been demonstrated in lysosomes of alveolar macrophages (Di et al 2006), which suggests that CFTR can also regulate phagosome acidification (Di et al 2006).…”

Co- and Posttranslational Translocation Mechanisms Direct Cystic Fibrosis Transmembrane Conductance Regulator N Terminus Transmembrane Assembly

“…AvaI/XbaI fragments containing the engineered mutations were then ligated into an AvaI/XbaI-digested pSPCFTR vector (34), generating plasmids pSPCFTR(E92A) and pSPCFTR(K95A). Plasmid pSPCFTR(E92A/ K95A) was generated by PCR amplification of pSPCFTR(E92A) (sense primer (SP6 promoter) ATTTAGGTGACACTATAG, and antisense primer TACTGCAGCGGTGACGGCGCCTAA), digestion of the PCR fragment with AvaI/PstI (PstI encoded in antisense oligonucleotides) and ligation of the fragment into an AvaI/PstI digested pSPCFTRK95A vector.…”

The Cytoplasmic C-terminal Fragment of Polycystin-1 Regulates a Ca2+-permeable Cation Channel

“…The direction of this shift in E rev indicates that CD16.7-PKD1(115-226)-stimulated current was more selective for cations than for anions. Oocytes were then ϳ90% depleted of intracellular chloride by overnight incubation in a Cl-free sodium methanesulfonate medium (31). Following subsequent acute injection with EGTA to minimize residual Ca 2ϩ -activated Cl Ϫ currents, oocytes expressing CD16.7-PKD1(115-226) continued to exhibit La 3ϩ -sensitive current (Fig.…”