A new leukocyte cell-derived chemotaxin-2 from marine fish grouper, Epinephelus coioides: Molecular cloning and expression analysis

Genomic organization, promoter characterization and expression analysis of the leukocyte cell-derived chemotaxin-2 gene in Epinephelus akaraa

“…In fish, the tissue expression profile of LECT2 shows a wider distribution, but the liver is also one of the most important tissues that produces LECT2 [23,27,28]. Together with our results, the observation of similar expression patterns of LECT2 in the liver may represent a conservation of universal functions between teleost and mammalian species.…”

“…This result suggests that in addition to the significant role of LECT2 in the inflammatory response, LECT2 may assert its pleiotropic nature and function under other conditions. An induced expression of LECT2 in livers has been recently reported in various fish species following injections of lipopolysaccharide [29], Gram-positive bacteria (Staphylococcus aureus [9,28]) or Gram-negative bacteria (Vibrio anguillarum [30], Aeromonas salmonicida [9], Vibrio vulnificus, Vibrio parahaemolyticus [28]). Based on the sharp increase in liver and the similar expression pattern in head kidney, it is reasonable to suppose that LECT2 in E. akaraa also functions early and with an important function in innate host defense [9] and could serve as a molecular indicator of bacterial infection.…”

Molecular cloning and expression of a C‐type lectin‐like protein from orange‐spotted grouper Epinephelus coioides

“…Expression and purification of recombinant Ec‐CTLP was assayed according to the method described by Wei et al (). Specific primers F3 (5′‐CGGGATCC GCTCCTCCTCCAGAGGAAACA‐3′) and R3 (5′‐GCTCTAGA TCATAATCTCTTCCTGGAGCGG‐3′) were used to amplify the DNA fragment encoding the mature peptide of Ec‐CTLP.…”

Expressed sequence tags (ESTs) based identification of genes and expression analysis of leukocyte cell-derived chemotaxin-2 (LECT2) from Epinephelus bruneus

“…The polyclonal antibody against rEbLECT2 was produced by immunizing BALB/c mice according to the conventional method (Wei et al, 2010;2011;Sambrook et al, 1989). The purified rEbLECT2 was mixed with equal volume of Freund's adjuvant (Sigma) and immunized mice by hypodermal injection at a dose of 100 mg per mouse at 7-day intervals.…”