A new RAPD marker for beet necrotic yellow vein virus resistance gene in Beta vulgaris

Amiri, R Maali; Mesbah, M; Moghaddam, Mohammad; Bihamta, Mohammad Reza; Mohammadi, Seyed Abolghasem; Norouzi, Peyman

doi:10.1007/s10535-009-0015-1

Cited by 19 publications

(7 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The RAPDs have proved to be important trait linked markers in horticulture crops like guava and sugar beet (Amiri et al 2009, Fereira-Romero et al 2009). DAMD markers are evenly distributed in the plant genome and exhibit relatively higher mutation rate (10 -3 ) (Tourmente et al 1998).…”

Section: ⎯⎯⎯⎯mentioning

confidence: 99%

Genetic variation within and among small isolated populations of Santalum album

Dani¹,

Ravikumar²,

Kumar³

et al. 2011

Biologia plant.

View full text Add to dashboard Cite

A combination of directed amplification of minisatellite DNA (DAMD) and random amplification of polymorphic DNA (RAPD) primes were used to assess the genetic variation within and between three isolated populations of Indian sandalwood (Santalum album). Eleven primers used in this study amplified 65.99 % polymorphic bands. Analysis of molecular variance revealed a high genetic variation among these populations (φ ST = 0.549). There are indications of clonality within the existing Indian sandalwood populations which can be attributed to habitat fragmentation, isolation and vegetative reproduction.

show abstract

Section: ⎯⎯⎯⎯mentioning

confidence: 99%

Genetic variation within and among small isolated populations of Santalum album

Dani¹,

Ravikumar²,

Kumar³

et al. 2011

Biologia plant.

View full text Add to dashboard Cite

show abstract

“…SS15 AGACGTCCAC Pelsy and Merdinoglu (1996) 28. SS16 GACAACAGGA Amiri et al (2009) TR1b GCAATTTTCAGGGCATGAACC Nishizawa et al (2000) 33. TR2a TTAATTGCGAGACCGGAGGC Nishizawa et al (2000) TR2b GAGCTTGCTCGCAGCTTATG Nishizawa et al (2000) 34.…”

Section: Overall Diversity Pattern Of Beta and Patellifoliamentioning

confidence: 99%

“…In case of rhizomania resistance there are many reports concerning identification of potentially useful molecular markers that turned out to segregate with the feature in different segregating populations and, as such, they may be potentially efficient tools for breeders (Barzen et al 1997;Giorio et al 1997;Scholten et al 1997;Gidner et al 2005;Lein et al 2006;Nouhi et al 2008;Amiri et al 2009;Feghhi et al 2012). However, functional significance for most of them is poorly understood yet, and all the more so because most of them may not necessarily be located within a single major gene.…”

Section: Rhizomania Resistance-segregating Markersmentioning

confidence: 99%

Evaluation of rhizomania-resistance segregating sequences and overall genetic diversity pattern among selected accessions of Beta and Patellifolia. Potential implications of breeding for genetic bottlenecks in terms of rhizomania resistance

et al. 2015

View full text Add to dashboard Cite

Sugar beet is hypothesized to have a narrowed genetic base due to its origin as White Silesian Beet and from numerous breeding selections and practices. High sugar quality, yield of recoverable sugar, cytoplasmic-male sterility system, monogermity, pests and disease resistance and bolting resistance constitute some of the adaptations that significantly influenced the existing genetic background of the crop. In this study we aimed to evaluate the extent of genetic diversity existing in wild beet representatives of Beta and Patellifolia and sugar beet cultivars, with a special focus on the complex Beta vulgaris. Another purpose was to determine the potential usefulness and conformity of selected molecular markers in different groups of materials in the context of rhizomania resistance. To reach these goals, molecular RAPD, ISSR techniques, literatureselected rhizomania resistance-segregating sequences as well as mitochondrial markers were used. The comparison of genetic diversity in wild and cultivated Beta forms shows that the population differentiation values and distance values are relatively high in cultivars. Moreover, the diversity component seemed to be compromised rather on the level of population (Hs) than in total (Ht) in cultivars. Our results shed a new light on the expected genetic bottlenecks existing in cultivars and revealed features specific for individual taxa (Patellifolia, Corollinae). Some degree of distinctiveness was suggested between genetic determinants of rhizomania resistance in modern cultivars in comparison with wild resistance sources. In addition, we document here an internal heterogeneity existing in selected wild/weedy accessions at the level of crucial sequences using high resolution melting.

show abstract

“…The exception is that of rhizomania resistance (Giorio et al 1997;Scholten and Lange 2000;Gidner et al 2005;Grimmer et al 2008;Amiri et al 2009). Rhizomania (crazy root) severely impacts yield and has worldwide economic importance.…”

Section: Present Situationmentioning

confidence: 99%

Assisted Breeding in Sugar Beets

McGrath

2010

Sugar Tech

View full text Add to dashboard Cite

Molecular insight and methods applied to plant breeding and germplasm enhancement is the goal of assisted breeding, also known as marker assisted breeding, marker assisted selection, molecular plant breeding, or genome-wide selection, among others. The basic idea is that most, if not all, heritable components of agronomic performance can be assayed with an unbiased, uniform, and comparatively inexpensive set of measures that are highly or completely correlated with phenotypic values. Typically such heritable components are genetically controlled, thus the panoply of DNA-based correlative methods should provide the requisite tools for assisted breeding to be successful. Whether DNA-based methods are successful in predicting agronomic performance depends on a host of considerations, many of which remain to be completely addressed for sugar beet, and thus assisted breeding remains somewhat empirical in practice, at least with respect to the specific traits of interest. Most sugar beet breeding and improvement programs have initiated assisted breeding efforts, primarily as a first step to discover marker associations with traits. These initial activities serve a number of important functions such as determining the complexity of trait inheritance, narrowing the possible range of genes and loci involved in phenotypic expression in different populations, and following the progress of sugar beet improvement following hybridization with wild and unadapted germplasm. It is unlikely that breeding will or should ever rely completely on assisted methods, however selection of the most promising germplasm can be greatly accelerated using molecular insights and knowledge.

show abstract

A new RAPD marker for beet necrotic yellow vein virus resistance gene in Beta vulgaris

Cited by 19 publications

References 32 publications

Genetic variation within and among small isolated populations of Santalum album

Genetic variation within and among small isolated populations of Santalum album

Evaluation of rhizomania-resistance segregating sequences and overall genetic diversity pattern among selected accessions of Beta and Patellifolia. Potential implications of breeding for genetic bottlenecks in terms of rhizomania resistance

Assisted Breeding in Sugar Beets

Contact Info

Product

Resources

About