A Novel Family of TRF (DNA Topoisomerase I-Related Function) Genes Required for Proper Nuclear Segregation

Castaño, Irene; Heath-Pagliuso, S.; Sadoff, Ben U.; Fitzhugh, David J.; Christman, Michael F.

doi:10.1093/nar/24.12.2404

Cited by 76 publications

(69 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Pap2 is not essential for this process in the cases we examined, most probably because it is partially redundant with Trf5, a TRAMP subunit homologous to and synthetically lethal with Pap2 (25,26). Further analysis of CUTs during meiosis revealed their staggered accumulation similar to SUTs and MUTs in sporulating MATa/α but typically not in starving MATα/α cells (Fig.…”

Section: Resultsmentioning

confidence: 89%

Execution of the meiotic noncoding RNA expression program and the onset of gametogenesis in yeast require the conserved exosome subunit Rrp6

Lardenois

Liu

Walther

et al. 2010

Proc. Natl. Acad. Sci. U.S.A.

126

217

View full text Add to dashboard Cite

Budding yeast noncoding RNAs (ncRNAs) are pervasively transcribed during mitosis, and some regulate mitotic protein-coding genes. However, little is known about ncRNA expression during meiotic development. Using high-resolution profiling we identified an extensive meiotic ncRNA expression program interlaced with the protein-coding transcriptome via sense/antisense transcript pairs, bidirectional promoters, and ncRNAs that overlap the regulatory regions of genes. Meiotic unannotated transcripts (MUTs) are mitotic targets of the conserved exosome component Rrp6, which itself is degraded after the onset of meiosis when MUTs and other ncRNAs accumulate in successive waves. Diploid cells lacking Rrp6 fail to initiate premeiotic DNA replication normally and cannot undergo efficient meiotic development. The present study demonstrates a unique function for budding yeast Rrp6 in degrading distinct classes of meiotically induced ncRNAs during vegetative growth and the onset of meiosis and thus points to a critical role of differential ncRNA expression in the execution of a conserved developmental program.

show abstract

Section: Resultsmentioning

confidence: 89%

Execution of the meiotic noncoding RNA expression program and the onset of gametogenesis in yeast require the conserved exosome subunit Rrp6

Lardenois

Liu

Walther

et al. 2010

Proc. Natl. Acad. Sci. U.S.A.

126

217

View full text Add to dashboard Cite

show abstract

“…Plasmid pCB427 (TRF4 URA3 CEN) was kindly provided by M. F. Christman (7). Plasmids for overexpression of cid1 and cid14 under the control of the GAL1 promoter were constructed by PCR amplification of the cid1 ϩ and cid14 ϩ open reading frames from S. pombe genomic DNA using the primer pairs CGCGGATCCGCGAATATGAACATTTCTTCT GCAC and ATAGTTTAGCGGCCGCATTCTTATTCACTCAGAATTGTCAC CATC and CGCGGATCCGCGGAGATGGGTAAAAAAAGCGTGTC and AT AGTTTAGCGGCCGCATTCTTATCTAAAAACGTTTGCGTATTTTTTTCGC, respectively, followed by digestion with BamHI and NotI and subsequent ligation into BamHI-and NotI-cleaved pYES2 (Invitrogen), generating pYES2cid1 and pYES2cid14.…”

Section: Methodsmentioning

confidence: 99%

Requirement of Fission Yeast Cid14 in Polyadenylation of rRNAs

Win

Draper

Read

et al. 2006

Molecular and Cellular Biology

View full text Add to dashboard Cite

Polyadenylation in eukaryotes is conventionally associated with increased nuclear export, translation, and stability of mRNAs. In contrast, recent studies suggest that the Trf4 and Trf5 proteins, members of a widespread family of noncanonical poly(A) polymerases, share an essential function in Saccharomyces cerevisiae that involves polyadenylation of nuclear RNAs as part of a pathway of exosome-mediated RNA turnover. Substrates for this pathway include aberrantly modified tRNAs and precursors of snoRNAs and rRNAs. Here we show that Cid14 is a Trf4/5 functional homolog in the distantly related fission yeast Schizosaccharomyces pombe. Unlike trf4 trf5 double mutants, cells lacking Cid14 are viable, though they suffer an increased frequency of chromosome missegregation. The Cid14 protein is constitutively nucleolar and is required for normal nucleolar structure. A minor population of polyadenylated rRNAs was identified. These RNAs accumulated in an exosome mutant, and their presence was largely dependent on Cid14, in line with a role for Cid14 in rRNA degradation. Surprisingly, both fully processed 25S rRNA and rRNA processing intermediates appear to be channeled into this pathway. Our data suggest that additional substrates may include the mRNAs of genes involved in meiotic regulation. Polyadenylation-assisted nuclear RNA turnover is therefore likely to be a common eukaryotic mechanism affecting diverse biological processes.In eukaryotic cells, most genes are transcribed into precursor messenger RNAs that have to undergo several processing events before maturation, including addition of a cap structure to the 5Ј terminus, removal of introns by splicing, and 3Ј cleavage and polyadenylation. A key player in the polyadenylation process is the nuclear poly(A) polymerase (PAP

show abstract

“…Limited restriction mapping placed the remaining library clones into three classes, and a member of each class was sequenced. One class of suppressor carried inserts containing the TRF4-related gene, TRF5 (15). This demonstrates that at least two genes from the evolutionarily conserved TRF4 gene family affect cellular sensitivity to camptothecin.…”

Section: Suppression Of Camptothecin Hypersensitivity In the Trf4 Mutmentioning

confidence: 97%

“…We have discovered that TOP1 functions, together with a novel gene called TRF4 (for Topoisomerase Related Function), in the process of mitotic chromosome condensation (14,15). Furthermore, we have shown that the Trf4 protein is physically associated with Smc1p and Smc2p (14), proteins that bind directly to chromosomes and cause condensation (16).…”

mentioning

confidence: 99%

The Topoisomerase-related Function Gene TRF4 Affects Cellular Sensitivity to the Antitumor Agent Camptothecin

Walowsky

Fitzhugh

Castaño

et al. 1999

Journal of Biological Chemistry

View full text Add to dashboard Cite

Camptothecin is an antitumor agent that kills cells by converting DNA topoisomerase I into a DNA-damaging poison. Although camptothecin derivatives are now being used to treat tumors in a variety of clinical protocols, the cellular factors that influence sensitivity to the drug are only beginning to be understood. We report here that two genes required for sister chromatid cohesion, TRF4 and MCD1/SCC1, are also required to repair camptothecin-mediated damage to DNA. The hypersensitivity to camptothecin in the trf4 mutant does not result from elevated expression of DNA topoisomerase I. We show that Trf4 is a nuclear protein whose expression is cell cycle-regulated at a post-transcriptional level. Suppression of camptothecin hypersensitivity in the trf4 mutant by gene overexpression resulted in the isolation of three genes: another member of the TRF4 gene family, TRF5, and two genes that may influence higher order chromosome structure, ZDS1 and ZDS2. We have isolated and sequenced two human TRF4 family members, hTRF4-1 and hTRF4-2. The hTRF4-1 gene maps to chromosome 5p15, a region of frequent copy number alteration in several tumor types. The evolutionary conservation of TRF4 suggests that it may also influence mammalian cell sensitivity to camptothecin.

show abstract

A Novel Family of TRF (DNA Topoisomerase I-Related Function) Genes Required for Proper Nuclear Segregation

Cited by 76 publications

References 32 publications

Execution of the meiotic noncoding RNA expression program and the onset of gametogenesis in yeast require the conserved exosome subunit Rrp6

Execution of the meiotic noncoding RNA expression program and the onset of gametogenesis in yeast require the conserved exosome subunit Rrp6

Requirement of Fission Yeast Cid14 in Polyadenylation of rRNAs

The Topoisomerase-related Function Gene TRF4 Affects Cellular Sensitivity to the Antitumor Agent Camptothecin

Contact Info

Product

Resources

About