A Novel Multiplex-PCR Assay to Detect Three Non-Halal Meats Contained
                    in Meatball using Mitochondrial 12S rRNA Gene

Cahyadi, Muhammad; Wibowo, Tommy; Pramono, Ahmad; Abdurrahman, Zakaria Husein

doi:10.5851/kosfa.2020.e40

Cited by 21 publications

(15 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Low bovine DNA concentration extracted from meatball made from meat mixtures may lead to less bright DNA band. More over, concentration of extracted DNA from mixed sam ples cannot be precisely similar for each species, and high temperature and grinding treatments may cause low DNA genomic harvested and amplicon (Cahyadi et al 2020). This study used genomic DNA harvested from designed meat samples.…”

Section: Discussionmentioning

confidence: 99%

“…They have been widely used for evolutionary and forensic studies due to abundantly avail able in the cells, maternally inherited, no recombination occurred, and high mutation rate among species (Lock ley and Bardsley 2000). Those properties make them very useful biomarker to construct phylogenetic tree and species discrimination including in animalbased products (Cahyadi et al 2020).…”

Section: Introductionmentioning

confidence: 99%

“…MultiplexPCR is a kind of conventional PCR devel oped to amplify several DNA targets simultaneously in one reaction tube using multiple primer pairs. This tech nique is much more efficient compared to speciesspecific PCR, PCRRFLP, or realtime PCR because it does not need more reagents or current technology (Cahyadi et al 2020). Previous study reported that utilizing mitochon drial Cytochrome b gene can detect goat, chicken, cattle, sheep, pig and horse genetic materials in raw and cooked meats (Matsunaga et al 1999).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Detection of species substitution in raw, cooked, and processed meats utilizing multiplex-PCR assay

Cahyadi

Fauzıah

Suwarto³

et al. 2021

Indones. J. Biotechnol.

Self Cite

View full text Add to dashboard Cite

The rise of beef consumption in Indonesia opens an opportunity for “rogue” suppliers to mix beef with other meat species that are relatively cheaper, such as pork, chicken, etc. The aim of this study was to identify pig and chicken meat in raw, cooked, and processed meat products using multiplex-PCR of mitochondrial DNA Cytochrome b gene, which is maternally inherited and widely used for forensic studies. A total of 90 samples-33 raw meats, 33 cooked meats, and 24 meatballs-were used in this study. Each sample was extracted to obtain the DNA genome and this was then amplified using multiplex-PCR. The PCR products were visualized using 2% agarose gel electrophoresis. The results showed that species contained in raw, cooked, and processed meat samples could be identified as indicated by DNA bands at 398, 274, 227, and 157 bp for pig, cattle, chicken, and goat species respectively. This study concluded that species substitution in raw, cooked, and processed meats could be detected using the Cytochrome b gene as a genetic marker through multiplex-PCR assay.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Detection of species substitution in raw, cooked, and processed meats utilizing multiplex-PCR assay

Cahyadi

Fauzıah

Suwarto³

et al. 2021

Indones. J. Biotechnol.

Self Cite

View full text Add to dashboard Cite

show abstract

“…Gen yang digunakan untuk mendesain kandidat primer adalah gen 12S rRNA babi [21]. Gen tersebut merupakan salah satu dari 37 gen DNA mitokondria (mtDNA) yang merupakan daerah pengkode suatu informasi genetika (coding region) [22].…”

Section: Article Historyunclassified

Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk

2021

View full text Add to dashboard Cite

Beberapa produk seperti obat, makanan, dan kosmetika khususnya kolagen dapat berpotensi mengandung turunan babi sehingga diperlukan adanya analisis kehalalan. . Polymerase Chain Reaction (PCR) merupakan metode yang dapat digunakan untuk melakukan analisis sampel secara molekuler. Tujuan dari penelitian ini adalah mendesain kandidat primer dari gen 12S rRNA babi secara in silico. . Metode yang digunakan adalah penelusuran data gen 12S rRNA melalui situs National Center for Biotechnology Information (NCBI), kemudian sekuen gen 12S rRNA dianalisis menggunakan server web Integrated DNA Technologies (IDT) dan MFEprimer-3.1 untuk dilakukan pemilihan kandidat primer terbaik. Kandidat primer terpilih kemudian diidentifikasi menggunakan server web SnapGene Viewer untuk mengamati kemampuan penempelan kandidat primer pada sekuen target. Pada tahap terakhir dilakukan evaluasi kandidat primer menggunakan server web OligoAnalyzer™ Tool agar diperoleh pasangan kandidat primer terbaik yang memenuhi kriteria primer yang baik. Kandidat primer yang terbaik adalah primer forward rRNA-5 (5’ GTACTACTCGCAACTGCCTAAA 3’) dan primer reverse rRNA-6 (5’GCAAGGGTTGGTAAGGTCTATC 3’) karena memenuhi persyaratan primer ideal. . Dengan demikian, kandidat primer tersebut dapat digunakan untuk karakterisasi sampel secara in vitro menggunakan teknik PCR.

show abstract

“…Nevertheless, factors such as feeding and slaughtering affect the availability of halal meats . Moreover, non‐essential halal foods such as sushi or meatballs may necessitate the attention of Muslim consumers because sushi may contain mirin (rice wine) and meatballs may contain pork (Cahyadi et al., 2020;). As the food supply chain becomes wider and more complex, consumers, particularly Muslims, must be cautious of their food content (Bonne & Verbeke, 2008).…”

Section: Introductionmentioning

confidence: 99%

Recent advances in halal food authentication: Challenges and strategies

Ruslan

Chin

et al. 2021

Journal of Food Science

View full text Add to dashboard Cite

Increasing public awareness of food quality and safety has prompted a rapid increase in food authentication of halal food, which covers the production method, technical processing, identification of undeclared components, and species substitution in halal food products. This urges for extensive research into analytical methods to obtain accurate and reliable results for monitoring and controlling the authenticity of halal food. Nonetheless, authentication of halal food is often challenging because of the complex nature of food and the increasing number of food adulterants that cause detection difficulties. This review provides a comprehensive and impartial overview of recent studies on the analytical techniques used in the analysis of halal food authenticity (from 1980 to the present, but there has been no significant trend in the choice of techniques for authentication of halal food during this period). Additionally, this review highlights the classification of different methodologies based on validity measures that provide valuable information for future developments in advanced technology. In addition, methodological developments, and novel emerging techniques as well as their implementations have been explored in the evaluation of halal food authentication. This includes food categories that require halal authentication, illustrating the advantages and disadvantages as well as shortcomings during the use of all approaches in the halal food industry.

show abstract

A Novel Multiplex-PCR Assay to Detect Three Non-Halal Meats Contained in Meatball using Mitochondrial 12S rRNA Gene

Cited by 21 publications

References 21 publications

Detection of species substitution in raw, cooked, and processed meats utilizing multiplex-PCR assay

Detection of species substitution in raw, cooked, and processed meats utilizing multiplex-PCR assay

Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk

Recent advances in halal food authentication: Challenges and strategies

Contact Info

Product

Resources

About