A novel PDZ domain-containing gene is essential for male sex differentiation and maintenance in yellow catfish (Pelteobagrus fulvidraco)

Cheng, Dan; Lin, Qiaohong; Gong, Gaorui; Yang, Tianyi; Xiong, Shuting; Xiong, Yang; Huang, Peipei; Gui, Jian‐Fang; Mei, Jie

doi:10.1016/j.scib.2018.08.012

Cited by 63 publications

(23 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The DNA templates for gRNA transcription were amplified by PCR technology with synthesized primers gRNA-F: GTAATACGACTCACTATATG TGGATTGCCCCGACGAGAGTTTTAGAGCTAGAAATAGC and gRNA-R: AAAA GCACCGACTCGGTGCC. The purified PCR amplification was transcribed into gRNA using the transcript Aid T7 High Yield Transcript kit (Thermo Scientific, USA) as described 34 . Cas9 plasmid was linearized by XbaI enzyme, purified and transcribed into Cas9 mRNA using the T7 mMESSAGE mMACHINE Kit (Ambition, USA).…”

Section: Methodsmentioning

confidence: 99%

Igf2bp3 maintains maternal RNA stability and ensures early embryo development in zebrafish

et al. 2020

Self Cite

View full text Add to dashboard Cite

Early embryogenesis relies on maternally inherited mRNAs. Although the mechanism of maternal mRNA degradation during maternal-to-zygotic transition (MZT) has been extensively studied in vertebrates, how the embryos maintain maternal mRNA stability remains unclear. Here, we identify Igf2bp3 as an important regulator of maternal mRNA stability in zebrafish. Depletion of maternal igf2bp3 destabilizes maternal mRNAs prior to MZT and leads to severe developmental defects, including abnormal cytoskeleton organization and cell division. However, the process of oogenesis and the expression levels of maternal mRNAs in unfertilized eggs are normal in maternal igf2bp3 mutants. Gene ontology analysis revealed that these functions are largely mediated by Igf2bp3-bound mRNAs. Indeed, Igf2bp3 depletion destabilizes while its overexpression enhances its targeting maternal mRNAs. Interestingly, igf2bp3 overexpression in wild-type embryos also causes a developmental delay. Altogether, these findings highlight an important function of Igf2bp3 in controlling early zebrafish embryogenesis by binding and regulating the stability of maternal mRNAs.

show abstract

Section: Methodsmentioning

confidence: 99%

Igf2bp3 maintains maternal RNA stability and ensures early embryo development in zebrafish

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…Recently, transgene and gene knockout technologies have been successively applied in yellow catfish to reveal the function of the domain present in PSD-95, Dlg and ZO-1/2 (pfpdz1 ) gene, a novel PDZ domain-containing gene in whose intron the sex-linked marker was located. The pfpdz1 gene plays an important role in male sex differentiation and maintenance in yellow catfish [ 8 ]. Taken together, these features provide a platform for gene-editing methods to study gene function.…”

Section: Data Descriptionmentioning

confidence: 99%

Chromosomal-level assembly of yellow catfish genome using third-generation DNA sequencing and Hi-C analysis

Gong

Cheng

Xiao³

et al. 2018

GigaScience

Self Cite

108

View full text Add to dashboard Cite

BackgroundThe yellow catfish, Pelteobagrus fulvidraco, belonging to the Siluriformes order, is an economically important freshwater aquaculture fish species in Asia, especially in Southern China. The aquaculture industry has recently been facing tremendous challenges in germplasm degeneration and poor disease resistance. As the yellow catfish exhibits notable sex dimorphism in growth, with adult males about two- to three-fold bigger than females, the way in which the aquaculture industry takes advantage of such sex dimorphism is another challenge. To address these issues, a high-quality reference genome of the yellow catfish would be a very useful resource.FindingsTo construct a high-quality reference genome for the yellow catfish, we generated 51.2 Gb short reads and 38.9 Gb long reads using Illumina and Pacific Biosciences (PacBio) sequencing platforms, respectively. The sequencing data were assembled into a 732.8 Mb genome assembly with a contig N50 length of 1.1 Mb. Additionally, we applied Hi-C technology to identify contacts among contigs, which were then used to assemble contigs into scaffolds, resulting in a genome assembly with 26 chromosomes and a scaffold N50 length of 25.8 Mb. Using 24,552 protein-coding genes annotated in the yellow catfish genome, the phylogenetic relationships of the yellow catfish with other teleosts showed that yellow catfish separated from the common ancestor of channel catfish ∼81.9 million years ago. We identified 1,717 gene families to be expanded in the yellow catfish, and those gene families are mainly enriched in the immune system, signal transduction, glycosphingolipid biosynthesis, and fatty acid biosynthesis.ConclusionsTaking advantage of Illumina, PacBio, and Hi-C technologies, we constructed the first high-quality chromosome-level genome assembly for the yellow catfish P. fulvidraco. The genomic resources generated in this work not only offer a valuable reference genome for functional genomics studies of yellow catfish to decipher the economic traits and sex determination but also provide important chromosome information for genome comparisons in the wider evolutionary research community.

show abstract

“…Sex-specific marker identification is a very effective method to reveal the sex determination mechanisms and further identify sexdetermining genes (Dan et al, 2018;Matsuda et al, 2002;Myosho et al, 2012;Takehana et al, 2014). In the past studies, many sexspecific molecular markers of different types have been successfully identified, such as restriction fragment length polymorphism (RFLP) (Devlin, Mcneil, Groves, & Donaldson, 1991;Mucci & Randi, 2007), simple sequence repeats (SSR) (Chen et al, 2015;Sakamoto et al, 2000), and amplified fragment length polymorphism (AFLP) (Dan, Mei, Wang, & Gui, 2013;Ezaz et al, 2004;Ma et al, 2010;Pan, Li, Zhou, Qiang, & Gui, 2015;Wang, Mao, Chen, Liu, & Gui, 2010;Wang et al, 2009).…”

mentioning

confidence: 99%

Identification of sex‐specific markers and heterogametic XX/XY sex determination system by 2b‐RAD sequencing in redtail catfish (Mystus wyckioides)

Zhou

Wu²,

Wang

et al. 2019

Aquac Res

Self Cite

View full text Add to dashboard Cite

Sex-specific markers provide significant molecular basis for sex control breeding biotechnology to produce all-male or all-female fish in commercial breeding. Redtail catfish (Mystus wyckioides), one of the commercial bagrid catfishes distributed in Southeast Asian, which have a long sexual maturation period that can last 3-5 years and males have apparent growth advantage over females, but its sex determination system remains unknown. In this study, we first applied 2b-RAD-seq approach to identify three male-specific 2b-RAD-tags and one male heterogametic SNP locus and validated by blast to the genome survey sequences and PCR amplification in both wild and breeding populations. To get longer sex-specific region, we performed genome walking and obtained a 4,630 bp of Y-specific sequence and 4,581 bp of X-specific sequence from the 2b-RADtag ref189950 with 92.19% nucleotide identity between them. And 9,923 bp/3,935 bp of Y-specific sequences and 8,491 bp/5,172 bp of X-specific sequences were also identified with 77.49% and 57.07% nucleotide identity in ref208528 and ref210837, respectively. Subsequently, three different kinds of sex-specific primers with different length products were designed based on the detected highly sex differentiated regions and could be used to distinguish males and females both in wild and artificially bred populations. What is more, the X-specific fragment was discovered to produce the dosage effect association in females and in males. The data suggest that male heterogametic XX/XY sex determination system should exist in the redtail catfish. More significantly, the sex-specific markers are of great value to protect wild resources and improve the efficiency of all-male breeding practices for aquaculture in the redtail catfish.

show abstract

A novel PDZ domain-containing gene is essential for male sex differentiation and maintenance in yellow catfish (Pelteobagrus fulvidraco)

Cited by 63 publications

References 45 publications

Igf2bp3 maintains maternal RNA stability and ensures early embryo development in zebrafish

Igf2bp3 maintains maternal RNA stability and ensures early embryo development in zebrafish

Chromosomal-level assembly of yellow catfish genome using third-generation DNA sequencing and Hi-C analysis

Identification of sex‐specific markers and heterogametic XX/XY sex determination system by 2b‐RAD sequencing in redtail catfish (Mystus wyckioides)

Contact Info

Product

Resources

About