A Novel Y319H Substitution in CYP51C Associated with Azole Resistance in Aspergillus flavus

Abstract

cThis study aimed to explore any mutation in the CYP51 gene conferring azole resistance in Aspergillus flavus. Two voriconazoleresistant and 45 voriconazole-susceptible isolates were included in the study. Sequence analysis demonstrated a T1025C nucleotide change in CYP51C, resulting in the Y319H amino acid substitution in one resistant isolate. However, the earlier described T788G mutation in CYP51C conferring voriconazole resistance in A. flavus isolates was present in all isolates, irrespective of their susceptibility status. Aspergillus flavus is the second leading cause of invasive aspergillosis in immunocompromised patients and the predominant causative agent of fungal rhinosinusitis and fungal eye infections (endophthalmitis and keratitis) in tropical countries, like India, Sudan, Kuwait,. Voriconazole is used primarily to treat infections caused by A. flavus. Long-term azole therapy may predispose A. flavus to acquire resistance to azoles, including voriconazole Lanosterol 14 ␣-demethylase (LDM), which catalyzes the ratelimiting step in the ergosterol biosynthetic pathway, serves as the primary target for azole antifungal drugs. The mechanism of azole resistance in Aspergillus fumigatus is well studied. Missense mutations and alteration of cis regulatory regions in the LDM coding gene CYP51A have been found to be the dominant mechanisms of azole resistance in A. fumigatus (9-12), whereas studies to evaluate the mechanism of azole resistance in A. flavus are sparse (13-15). The present study is an attempt to understand the mechanism of azole resistance in A. flavus.Two non-wild-type (non-WT) clinical isolates of A. flavus, NCPPF 761157 and NCCPF 760815, with higher MIC values for voriconazole than for the respective wild-type (WT) cutoff value, and 4 WT isolates were initially used ( Table 1). The wild type and non-wild type were defined on the basis of epidemiological cutoff values (ECV), with the non-WT having a voriconazole MIC of Ͼ1 g/ml and WT with a voriconazole MIC of Յ1 g/ml (16). The non-WT strain, NCCPF 761157, was isolated from a sputum sample from a patient with chronic obstructive pulmonary disease, and NCCPF 760815 was isolated from a nasal tissue sample from a patient from India having granulomatous fungal rhinosinusitis. Forty-five additional WT A. flavus clinical isolates were included to screen and validate the mutations (single-nucleotide polymorphisms [SNPs] and indels). Identification of the isolates was done by sequencing partial ␤-tubulin and calmodulin genes using primers bt2a (GGTAACCAAATCGGTGCTGCTTTC) and bt2b (ACCCTCAGTGTAGTGACCCTTGGC), and cmdA7 (GCCAAA ATCT TCATCCGTAG) and cmdA8 (ATTTCGTTCAGAATGCC AGG) (17, 18). Antifungal susceptibility testing was done as per CLSI and EUCAST guidelines (19)(20)(21)(22). Coding sequences of the close homologues of CYP51A of A. fumigatus in A. flavus, namely CYP51A (GenBank accession no. XM_002375082.1), CYP51B (GenBank accession no. XM_002379089.1), and CYP51C (GenBank accession no. XM_002383890.1), were downloaded from GenBank (http://www.nc...

Isavuconazole for treatment of invasive fungal diseases caused by more than one fungal species

“…An MIC value >16 μg/ml was observed for an isolate of A. flavus from Patient 3 (see Results). This result could have been spurious, or may represent a case of azole resistance, which has recently been described in A. flavus isolates 45,46. The R. arrhizus isolate from Patient 10 was found to have an MIC for isavuconazole of >16 μg/ml using both methods, which may represent an R. arrhizus var.…”

Pharmacodynamics of Voriconazole against Wild-Type and Azole-Resistant Aspergillus flavus Isolates in a Nonneutropenic Murine Model of Disseminated Aspergillosis

“…Therefore, one could consider that standard dosing of voriconazole could be used for the successful treatment of infections caused by A. flavus for which MICs are as high as 2 to 4 mg/liter. Alarmingly, azole resistance is now reported in cases of aspergillosis due to A. flavus (16). In countries like India, where A. flavus is the primary fungus causing cerebral or sino-orbital aspergillosis, the situation is far more crucial (4, 6).…”

“…This model indicated that the Y319H substitution was located far from the iron porphyrin complex and hence did not have a direct effect on the docking of the azoles at the binding site. Instead this mutation exhibited increased conformational flexibility, probably due to polar nature of histidine which causes interatomic repulsion leading to reduced drug binding affinity (16). A third explanation could be a difference in levels of virulence between susceptible and resistant strains.…”

“…Mutations in the cyp51A(T788G) and cyp51C(Y319H) (16) genes encoding the azole target enzyme have been associated with increased MICs of voriconazole. Given the prominent role of azoles in the management of aspergillosis due to A. flavus, it is important to determine if a mutation in the cyp51 gene in A. flavus corresponds with reduced in vivo efficacy.…”

Genetic Diversity and In Vitro Antifungal Susceptibility of 200 Clinical and Environmental Aspergillus flavus Isolates

“…However, with the widespread use of azoles in clinical practice and agriculture, the emergence of triazole resistance in A. fumigatus has become a global public health concern. Moreover, mutations in A. flavus cyp51A (T788G) and cyp51C (Y319H), both associated with increased MICs to voriconazole, have also been reported recently (11).…”