Dermatophytosis, the commonest superficial fungal infection, has gained recent attention due to its change of epidemiology and treatment failures. Despite the availability of several agents effective against dermatophytes, the incidences of chronic infection, reinfection, and treatment failures are on the rise. and are the two species most frequently identified among clinical isolates in India. Consecutive patients ( = 195) with suspected dermatophytosis during the second half of 2014 were included in this study. Patients were categorized into relapse and new cases according to standard definitions. Antifungal susceptibility testing of the isolated species ( = 127) was carried out with 12 antifungal agents: fluconazole, voriconazole, itraconazole, ketoconazole, sertaconazole, clotrimazole, terbinafine, naftifine, amorolfine, ciclopirox olamine, griseofulvin, and luliconazole. The squalene epoxidase gene was evaluated for mutation (if any) in 15 and 5 isolates exhibiting high MICs for terbinafine. A T1189C mutation was observed in four and two isolates. This transition leads to the change of phenylalanine to leucine in the 397th position of the squalene epoxidase enzyme. In homology modeling the mutant residue was smaller than the wild type and positioned in the dominant site of squalene epoxidase during drug interaction, which may lead to a failure to block the ergosterol biosynthesis pathway by the antifungal drug.

Although C. auris infection has been observed across India, the number of cases is higher in public-sector hospitals in the north of the country. Longer stay in ICU, underlying respiratory illness, vascular surgery, medical intervention and antifungal exposure are the major risk factors for acquiring C. auris infection even among patients showing lower levels of morbidity.

Aspergillus flavus is the second most common etiological agent of invasive aspergillosis (IA) after A. fumigatus. However, most literature describes IA in relation to A. fumigatus or together with other Aspergillus species. Certain differences exist in IA caused by A. flavus and A. fumigatus and studies on A. flavus infections are increasing. Hence, we performed a comprehensive updated review on IA due to A. flavus. A. flavus is the cause of a broad spectrum of human diseases predominantly in Asia, the Middle East, and Africa possibly due to its ability to survive better in hot and arid climatic conditions compared to other Aspergillus spp. Worldwide, ~10% of cases of bronchopulmonary aspergillosis are caused by A. flavus. Outbreaks have usually been associated with construction activities as invasive pulmonary aspergillosis in immunocompromised patients and cutaneous, subcutaneous, and mucosal forms in immunocompetent individuals. Multilocus microsatellite typing is well standardized to differentiate A. flavus isolates into different clades. A. flavus is intrinsically resistant to polyenes. In contrast to A. fumigatus, triazole resistance infrequently occurs in A. flavus and is associated with mutations in the cyp51C gene. Overexpression of efflux pumps in non-wildtype strains lacking mutations in the cyp51 gene can also lead to high voriconazole minimum inhibitory concentrations. Voriconazole remains the drug of choice for treatment, and amphotericin B should be avoided. Primary therapy with echinocandins is not the first choice but the combination with voriconazole or as monotherapy may be used when the azoles and amphotericin B are contraindicated.

cThis study aimed to explore any mutation in the CYP51 gene conferring azole resistance in Aspergillus flavus. Two voriconazoleresistant and 45 voriconazole-susceptible isolates were included in the study. Sequence analysis demonstrated a T1025C nucleotide change in CYP51C, resulting in the Y319H amino acid substitution in one resistant isolate. However, the earlier described T788G mutation in CYP51C conferring voriconazole resistance in A. flavus isolates was present in all isolates, irrespective of their susceptibility status. Aspergillus flavus is the second leading cause of invasive aspergillosis in immunocompromised patients and the predominant causative agent of fungal rhinosinusitis and fungal eye infections (endophthalmitis and keratitis) in tropical countries, like India, Sudan, Kuwait,. Voriconazole is used primarily to treat infections caused by A. flavus. Long-term azole therapy may predispose A. flavus to acquire resistance to azoles, including voriconazole Lanosterol 14 ␣-demethylase (LDM), which catalyzes the ratelimiting step in the ergosterol biosynthetic pathway, serves as the primary target for azole antifungal drugs. The mechanism of azole resistance in Aspergillus fumigatus is well studied. Missense mutations and alteration of cis regulatory regions in the LDM coding gene CYP51A have been found to be the dominant mechanisms of azole resistance in A. fumigatus (9-12), whereas studies to evaluate the mechanism of azole resistance in A. flavus are sparse (13-15). The present study is an attempt to understand the mechanism of azole resistance in A. flavus.Two non-wild-type (non-WT) clinical isolates of A. flavus, NCPPF 761157 and NCCPF 760815, with higher MIC values for voriconazole than for the respective wild-type (WT) cutoff value, and 4 WT isolates were initially used ( Table 1). The wild type and non-wild type were defined on the basis of epidemiological cutoff values (ECV), with the non-WT having a voriconazole MIC of Ͼ1 g/ml and WT with a voriconazole MIC of Յ1 g/ml (16). The non-WT strain, NCCPF 761157, was isolated from a sputum sample from a patient with chronic obstructive pulmonary disease, and NCCPF 760815 was isolated from a nasal tissue sample from a patient from India having granulomatous fungal rhinosinusitis. Forty-five additional WT A. flavus clinical isolates were included to screen and validate the mutations (single-nucleotide polymorphisms [SNPs] and indels). Identification of the isolates was done by sequencing partial ␤-tubulin and calmodulin genes using primers bt2a (GGTAACCAAATCGGTGCTGCTTTC) and bt2b (ACCCTCAGTGTAGTGACCCTTGGC), and cmdA7 (GCCAAA ATCT TCATCCGTAG) and cmdA8 (ATTTCGTTCAGAATGCC AGG) (17, 18). Antifungal susceptibility testing was done as per CLSI and EUCAST guidelines (19)(20)(21)(22). Coding sequences of the close homologues of CYP51A of A. fumigatus in A. flavus, namely CYP51A (GenBank accession no. XM_002375082.1), CYP51B (GenBank accession no. XM_002379089.1), and CYP51C (GenBank accession no. XM_002383890.1), were downloaded from GenBank (http://www.nc...

The rare mucoraceous fungus, Apophysomyces species complex ranks second after Rhizopus arrhizus causing mucormycosis in India. The source of this agent in the environment is not clearly known. We conducted an environmental study to find its presence in Indian soil. The soil samples from different geographical locations were analyzed for isolation of Mucorales. Rhizopus arrhizus (24.6%) was most commonly isolated from soil, followed by Lichtheimia spp. (23.2%), Cunninghamella spp. (21.7%), Rhizopus microsporus (14%) and Apophysomyces spp. (4.5%). The isolation of Apophysomyces species complex was significantly associated with low nitrogen content of the soil. Based on sequencing of internal transcribed spacer (ITS) and 28S (D1/D2) regions of ribosomal DNA, the Apophysomyces isolates were identified as Apophysomyces variabilis with 98 to 100% similarity to type strain A. variabilis (CBS658.93). The analysis of amplified fragment length polymorphism (AFLP) fingerprinting data demonstrated genomic diversity of A. variabilis isolates with multiple clades (similarity 40-90%). The minimum inhibitory concentrations (MIC), MIC50 and MIC90 for A. variabilis isolates were 1 and 4 μg/ml for amphotericin B, 0.25 and 0.5 μg/ml for itraconazole, 0.125 and 0.25 μg/ml for posaconazole, 0.06 and 0.12 μg/ml for terbinafine, respectively. The present study revealed abundant presence of A. variabilis in Indian soil with low nitrogen content, its genetic heterogeneity and relatively high MICs for amphotericin B.