A novelnull mutation in the rhodopsin gene causing late onset autosomal dominant retinitis pigmentosa

Abstract

Liss, Inc. 'To whom reprint requestdcorrespondence should be addressed.Retinitis pigmentosa (RP) is the most common inherited retinal degeneration. Mutations in the rhodopsin gene account for a subset of autosomal dominant (ad) RP. Three stop codon mutations have been identified in the rhodopsin gene, namely Q344X (Sung et al., 1991), Q64X (Macke et al., 1993), and E249X (Rosenfeld et al., 1992). Q344X and Q64X have been associated with adRP. E249X has been related to autosomal recessive RP. Here we report the fourth nonsense mutation located at codon 136 within exon 2 of the rhodopsin gene in a Spanish family with late onset mild autosomal dominant retinitis pigmentosa (adRP). Using the met'hod of single strand conformation polymorphism (SSCP) to detect mutations in rhodopsin coding sequences, we analyzed the DNA of the family members with adRP. After PCR amplification of exon 2 of rhodopsin gene using the primers sense 5'GCAGTGGGGTCTGTGCTGAC3', antisense 5'AGAGC-CCCCGGAGCTTCTTC3', an altered SSCP pattern was detected in affected individuals. Direct sequencing of exon 2 revealed a C-to-A transversion in codon 136 resulting in a nonsense mutation Y136X. This mutation was present in heterozygous condition. The C-to-A transversion in codon 136 abolishes a RsaI restriction site in exon 2. Digestion of normal DNA yields two fragments (165 and 86 bp). The loss of the RsaI restriction site in the mutant allele results in an additional 251-bp fragment in affected individuals. Using this assay none of the 150 normal unrelated control individuals tested showed the loss of the RsaI site.Younger individuals carrying Y136X mutation (aged 34, 42, and 43) show characteristic pigmentary deposits in fundi with normal ERG, indicating a well-preserved photoreceptor function, while the ophthalmological examination of the older individual (aged 75) is consistent with RP in advanced stage.It has been reported that the primary consequence of a premature termination codon (FTC) is a severe reduction in the level of mRNA of mutant allele (Beserga et al., 1988) more than the production of a truncated polypeptide. The degree to which the mRNA level was affected appears to depend on the mutation site in the coding sequence (Urlaub et al., 1989). It suggests that mutation Y136X may result in a reduction in the amount of transcript from the mutant allele leading to lower expression of aberrant protein and a milder phenotype. The different clinical expresion observed between individuals with nonsense mutations E249X (Rosenfeld et al., 1992) and Y136X in a heterozygous status suggests that there may be factors other than the reduction in the level of mRNA of mutant allele influencing the clinical expresion in these cases. ACKNOWLEDGMENTSThis work has been supported by the Fondo de Investigaciones Sanitarias (94/0758), the Federacih de Asociaciones de Retinitis Pigmentaria del Estado Espadol, and the Fundaci6n ONCE.

Signal transduction in the retina and inherited retinopathies

“…This variable clinical expression among patients of a comparable age with the same gene defect appears to be common for many rhodopsin gene mutations. For instance, a conservative change at codon 137 (Val-137-Met) seems to produce only mild symptoms in some affected individuals [57] and mutation at codon 136 (Y136X) produces no apparent visual problems in younger individuals [58]. Patients carrying a Pro-347-Arg mutation show less severe disease and below the age of 40 do not develop retinal hyperpigmentation [59] whereas patients with a Pro-347-Leu mutation display a significantly smaller visual field area, more extensive impairment and a range of abnormality among different patients [60].…”

Nonsense mutations in the rhodopsin gene that give rise to mild phenotypes trigger mRNA degradation in human cells by nonsense-mediated decay

“…Five rhodopsin nonsense mutations—Y60X, Q64X, Q312X, Q341X and Q344X—give rise to dominant RP (Cideciyan et al, 1998; Eisenberger et al, 2013; Macke et al, 1993; Sung et al, 1991; Zhao et al, 2001). In addition, nonsense mutation Y136X, although dominant, causes a very mild form of late onset RP (Sanchez et al, 1996). It is unclear whether the different phenotypes of these eight nonsense mutations result from varying toxicities of the truncated proteins or from the differential effects of nonsense-mediated decay (NMD) on the stability of the PTCcontaining rhodopsin mRNAs.…”

“…Nonsense mutations that induce NMD give rise to recessive RP (in the case of W161X and E249X) or to a dominant form with a mild phenotype (in the case Y136X). For Y136X and E249X, it has previously been speculated that NMD might account for their mild phenotypes (Rosenfeld et al, 1992; Sanchez et al, 1996). By contrast, Q64X and Q344X, which evade NMD, give rise to dominant RP.…”

Prevalence of Rhodopsin mutations in autosomal dominant Retinitis Pigmentosa in Spain: clinical and analytical review in 200 families

“…Some authors consider that nonsense mutations in the RHO gene are recessive alleles (Rosenfeld et al 1992;Kumaramanickavel et al 1994;Kartasasmita et al 2011) unless they happen in the last exon (Sung et al 1991). Nerveless stop-codon mutations in other exons have also been associated with adRP (Macke et al 1993;S anchez et al 1996;Eisenberger et al 2013).…”