Liss, Inc. 'To whom reprint requestdcorrespondence should be addressed.Retinitis pigmentosa (RP) is the most common inherited retinal degeneration. Mutations in the rhodopsin gene account for a subset of autosomal dominant (ad) RP. Three stop codon mutations have been identified in the rhodopsin gene, namely Q344X (Sung et al., 1991), Q64X (Macke et al., 1993), and E249X (Rosenfeld et al., 1992). Q344X and Q64X have been associated with adRP. E249X has been related to autosomal recessive RP. Here we report the fourth nonsense mutation located at codon 136 within exon 2 of the rhodopsin gene in a Spanish family with late onset mild autosomal dominant retinitis pigmentosa (adRP). Using the met'hod of single strand conformation polymorphism (SSCP) to detect mutations in rhodopsin coding sequences, we analyzed the DNA of the family members with adRP. After PCR amplification of exon 2 of rhodopsin gene using the primers sense 5'GCAGTGGGGTCTGTGCTGAC3', antisense 5'AGAGC-CCCCGGAGCTTCTTC3', an altered SSCP pattern was detected in affected individuals. Direct sequencing of exon 2 revealed a C-to-A transversion in codon 136 resulting in a nonsense mutation Y136X. This mutation was present in heterozygous condition. The C-to-A transversion in codon 136 abolishes a RsaI restriction site in exon 2. Digestion of normal DNA yields two fragments (165 and 86 bp). The loss of the RsaI restriction site in the mutant allele results in an additional 251-bp fragment in affected individuals. Using this assay none of the 150 normal unrelated control individuals tested showed the loss of the RsaI site.Younger individuals carrying Y136X mutation (aged 34, 42, and 43) show characteristic pigmentary deposits in fundi with normal ERG, indicating a well-preserved photoreceptor function, while the ophthalmological examination of the older individual (aged 75) is consistent with RP in advanced stage.It has been reported that the primary consequence of a premature termination codon (FTC) is a severe reduction in the level of mRNA of mutant allele (Beserga et al., 1988) more than the production of a truncated polypeptide. The degree to which the mRNA level was affected appears to depend on the mutation site in the coding sequence (Urlaub et al., 1989). It suggests that mutation Y136X may result in a reduction in the amount of transcript from the mutant allele leading to lower expression of aberrant protein and a milder phenotype. The different clinical expresion observed between individuals with nonsense mutations E249X (Rosenfeld et al., 1992) and Y136X in a heterozygous status suggests that there may be factors other than the reduction in the level of mRNA of mutant allele influencing the clinical expresion in these cases. ACKNOWLEDGMENTSThis work has been supported by the Fondo de Investigaciones Sanitarias (94/0758), the Federacih de Asociaciones de Retinitis Pigmentaria del Estado Espadol, and the Fundaci6n ONCE.

To the best of our knowledge this is the first report of findings in foveal hypoplasia examined by angio-optical coherence tomography. Optical coherence tomography angiography is an easy, rapid, and noninvasive tool that allows imaging of the retinal microvasculature without intravenous dye injection.

No abstract

No abstract