A RabGAP Regulates Life-Cycle Duration via Trimeric G-protein Cascades in Dictyostelium discoideum

Abstract

BackgroundThe life-cycle of cellular slime molds comprises chronobiologically regulated processes. During the growth phase, the amoeboid cells proliferate at a definite rate. Upon starvation, they synthesize cAMP as both first and second messengers in signalling pathways and form aggregates, migrating slugs, and fruiting bodies, consisting of spores and stalk cells, within 24 h. In Dictyostelium discoideum, because most growth-specific events cease during development, proliferative and heterochronic mutations are not considered to be interrelated and no genetic factor governing the entire life-cycle duration has ever been identified.Methodology/Principal FindingsUsing yeast 2-hybrid library screening, we isolated a Dictyostelium discoideum RabGAP, Dd Rbg-3, as a candidate molecule by which the Dictyostelium Gα2 subunit directs its effects. Rab GTPase-activating protein, RabGAP, acts as a negative regulator of Rab small GTPases, which orchestrate the intracellular membrane trafficking involved in cell proliferation. Deletion mutants of Dd rbg-3 exhibited an increased growth rate and a shortened developmental period, while an overexpression mutant demonstrated the opposite effects. We also show that Dd Rbg-3 interacts with 2 Gα subunits in an activity-dependent manner in vitro. Furthermore, both human and Caenorhabditis elegans rbg-3 homologs complemented the Dd rbg-3–deletion phenotype in D. discoideum, indicating that similar pathways may be generally conserved in multicellular organisms.Conclusions/SignificanceOur findings suggest that Dd Rbg-3 acts as a key element regulating the duration of D. discoideum life-span potentially via trimeric G-protein cascades.

A striatal-enriched intronic GPCR modulates huntingtin levels and toxicity

“…The reported small GTPases downstream of these GEFs are Rap1 and Rap2, and thus we tested their potential involvement by dominant negative and constitutively active Rap proteins ( Fu et al, 2007 ). None of these showed obvious effects on the Htt lowering by Gpr52 knock-down ( Figure 3—figure supplement 3 ), suggesting novel mechanisms potentially involving other GEFs and/or small GTPases, which is suggested in other models as well ( Emery and Eiden, 2012 ; Kuwayama et al, 2013 ). Given that the major function of small GTPases is trafficking, we tested potential Htt translocation events upon treatments of PKA-insensitive analogs Rp-cAMP or 8-pCPT-2′-O-Me cAMP, and found that they lead to Htt enrichment at the perinuclear regions and co-localization with the endoplasmic reticulumn (ER) marker ( Figure 3E ).…”

Deletion of gmfA induces keratocyte‐like migration inDictyostelium

“…Full‐length gmf A was amplified with a cDNA mixture prepared from aggregation‐stage mRNA using an oligo‐dT primer and verified by sequencing. To construct the overexpression and fluorescent protein fusion vectors, the full‐length gmf A cDNA was fused with the HA‐tag sequence (YPYDVPDYA) at the 5′‐region by PCR and cloned into the cloning site of the expression vector pHK12neo‐N‐Venus [ 52 ]. The expression vector of GFP‐Arp3 was obtained from NBRP Nenkin [ 28 ].…”

Differentiation‐inducing factor 2 modulates chemotaxis via the histidine kinase DhkC‐dependent pathway in Dictyostelium discoideum

“…The amplified fragment was verified by sequencing. For constructing the overexpression mutant, the full‐length Dd dhkC cDNA was cloned into the cloning site of pHK12neo . After transformation, a neomycin‐resistant clone was isolated as a dhkC overexpression mutant (designated dhkC OE ).…”

“…Reverse transcription‐polymerase chain reaction (RT‐PCR) amplification of dhkC was performed as described previously , by using the DNA primers 5′‐TTATCACCAAGAGCCCCAAC‐3′ and 5′‐AATTGAGCAACGGCTTTCTC‐3′.…”