A Rapid and Sensitive Detection of Aflatoxin-producing Fungus Using an Optimized Polymerase Chain Reaction (PCR)

Abstract

Aflatoxin B1 (AFB1) is produced by Aspergillus flavus growing in feedstuffs. Early detection of maize contamination by aflatoxigenic fungi is advantageous since aflatoxins exert adverse health effects. In this study, we report the development of an optimized conventional PCR for AFB1 detection and a rapid, sensitive and simple screening Real-time PCR (qPCR) with SYBR Green and two pairs of primers targeting the aflR genes which involved aflatoxin biosynthesis. AFB1 contaminated maize samples were divided into three groups by the toxin concentration. Genomic DNA was extracted from those samples. The target genes for A. flavus were tested by conventional PCR and the PCR products were analyzed by electrophoresis. A conventional PCR was carried out as nested PCR to verify the gene amplicon sizes. PCR-RFLP patterns, obtained with Hinc II and Pvu II enzyme analysis showed the differences to distinguish aflatoxin-producing fungi. However, they are not quantitative and need a separation of the products on gel and their visualization under UV light. On the other hand, qPCR facilitates the monitoring of the reaction as it progresses. It does not require post-PCR handling, which reduces the risk of cross-contamination and handling errors. It results in a much faster throughout. We found that the optimal primer annealing temperature was 65°C. The optimized template and primer concentration were 1.5 μL (50 ng/μL) and 3 μL (10 μM/μL) respectively. SYBR Green qPCR of four genes demonstrated amplification curves and melting peaks for tub1, afIM, afIR, and afID genes are at 88.0°C, 87.5°C, 83.5°C, and 89.5°C respectively. Consequently, it was found that the four primers had elevated annealing temperatures, nevertheless it is desirable since it enhances the DNA binding specificity of the dye. New qPCR protocol could be employed for the determination of aflatoxin content in feedstuff samples.

Molecular identification of aflatoxigenic Aspergillus species in feedstuff samples

“…Given the technical difficulties of conventional methods in the detection of aflatoxin-producing Aspergillus , scientists have opted for new and sensitive methods for the early detection of foodstuff contamination with different aflatoxigenic Aspergillus species [ 18 - 20 ]. Among the different genes involving in aflatoxin biosynthesis pathway, aflD plays an important role in the early conversion of nosolorinic acid into averantin.…”

Addition of Carbon to the Culture Medium Improves the Detection Efficiency of Aflatoxin Synthetic Fungi

“…Additionally, many brewery fungi, including A. oryzae or A. sojae , contain some of these genes. To discriminate AF synthetic strains from non-toxigenic strains, polymerase chain reaction studies that target AF gene clusters have been conducted, and these strategies are effective [10,11,12,13]. However, the primer sets sometimes miss strains that produce AF [8].…”

Diversity of Toxigenic Molds and Mycotoxins Isolated from Dairy Products: Antifungal Activity of Egyptian Marine Algae on Aspergillus and Candida Species

“…The target fragment of regulatory aflatoxin gene fragments of aflatoxigenic DNA was amplified by PCR. The forward-reverse primers aflR1 regulatory gene was; 5ˉ AACCGCATCCACAATCTCAT 3ˉ, and 5ˉAGTGCAGTTCGCTCAGAACA 3ˉ, involved within 800-base pairs (bp) gene size 36 . The reaction mixtures consisted of extracted A. flavus target DNA, forward primer (F), reverse primer (R) and PCR Master Mix: DreamTaq Green PCR Master Mix (2X) (Thermo Scientific, USA, Cat., No.…”