A signal motif retains Arabidopsis ER-α-mannosidase I in the cis-Golgi and prevents enhanced glycoprotein ERAD

Abstract

The Arabidopsis ER-α-mannosidase I (MNS3) generates an oligomannosidic N-glycan structure that is characteristically found on ER-resident glycoproteins. The enzyme itself has so far not been detected in the ER. Here, we provide evidence that in plants MNS3 exclusively resides in the Golgi apparatus at steady-state. Notably, MNS3 remains on dispersed punctate structures when subjected to different approaches that commonly result in the relocation of Golgi enzymes to the ER. Responsible for this rare behavior is an amino acid signal motif (LPYS) within the cytoplasmic tail of MNS3 that acts as a specific Golgi retention signal. This retention is a means to spatially separate MNS3 from ER-localized mannose trimming steps that generate the glycan signal required for flagging terminally misfolded glycoproteins for ERAD. The physiological importance of the very specific MNS3 localization is demonstrated here by means of a structurally impaired variant of the brassinosteroid receptor BRASSINOSTEROID INSENSITIVE 1.

Efficient N-Glycosylation of the Heavy Chain Tailpiece Promotes the Formation of Plant-Produced Dimeric IgA

“…The CRT2 coding sequence was amplified from A. thaliana cDNA using the primers "TATATCTAGAATGGCGAAAATGATTCCTA GCC"/"TATAGGATCCAGCGGTGGCGTCTTTCTCAGAGG." The PCR product was XbaI/BamHI digested and cloned into the expression vector p59 (Schoberer et al, 2019) to express CRT2 fused to mRFP-HDEL. CNX1 was amplified from A. thaliana cDNA using "TATATCTAGAGACGATCAAACGGTT CTGTATG"/"TATAGGATCCCTAATTATCACGTCTCGGTT GCC, " XbaI/BamHI digested and cloned into expression vector p110 (same vector as p117 but with a kanamycin resistance gene for selection in plants) to express an mRFP-CNX1 variant.…”

Living on the edge: the role of Atgolgin‐84A at the plant ER–Golgi interface

“…Furthermore, the previously described Golgi glycosylation enzyme Golgi‐α‐mannosidase I (MnSI, Fig. 3B) (Schoberer et al ., 2010; Schoberer et al ., 2019) located in the cis /medial‐Golgi stacks is expressed alongside Atgolgin‐84A. Atgolgin‐84A shows a distinct shift from the cis /medial‐Golgi enzyme MnSI (Fig.…”

“…In plant cells, intercisternal elements and a ribosome‐excluding zone around the Golgi body were shown by electron microscopy; this has been suggested to be an equivalent of the Golgi matrix (Kristen, 1978; Staehelin & Moore, 1995). Other proteins to remain in Golgi remnants upon BFA treatment are the SNARE protein AtSYP31 (Witte et al ., 2011; Ito et al ., 2012; Ito et al ., 2018) and the Arabidopsis mannosidase MNS3 (Schoberer et al ., 2019).…”

“…Constructs were transformed into the Agrobacterium tumefaciens strain GV3101::mp90. The following markers were used for colocalization assays and secretion assays: MnSI‐mRFP (Schoberer et al ., 2019), ST‐GFP (Boevink et al ., 1998), mRFP‐AtCASP (Renna et al ., 2005; Latijnhouwers et al ., 2007; Osterrieder et al ., 2017) and SP‐mCherry (Da Costa et al ., 2010).…”

A brief history of the octopus imaging facility to celebrate its 10th anniversary

“…The most recent breakthrough by Chris Hawes' colleagues was the discovery of the puzzling location of the Arabidopsis ER-α-mannosidase I (MNS3), a crucial enzyme responsible for the last N-glycan processing step evolutionary conserved across yeast, mammals and plants. 42 N-glycosylation, whose primary function is to enhance the solubility of protein folding intermediates, begins at the ER by transferring the preassembled oligosaccharide precursor Glc3Man9GlcNAc2 en bloc onto selected asparagine-led sequences of the nascent polypeptide chain (Fig. 3A).…”