A specific tRNA half, 5’tiRNA-His-GTG, responds to hypoxia via the HIF1α/ANG axis and promotes colorectal cancer progression by regulating LATS2

Tao, En-Wei; Wang, Hao-Lian; Cheng, Wing Yin; Liu, Qianqian; Chen, Yingxuan; Gao, Qin-Yan

doi:10.1186/s13046-021-01836-7

Cited by 85 publications

(85 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Its stable structure and high expression in body fluids make it relatively easy to detect, which makes it possible to become a new potential biomarker for tumors. Currently, most studies on tsRNAs have described the effects on proliferation, invasion, and migration of tumor cells and the mechanisms involved in hypoxia and epithelial to mesenchymal transformation (EMT) ( 10 , 21 , 51 , 52 ). However, there are few studies on whether tsRNAs can be used as a biomarker for tumors ( 18 , 24 , 53 ).…”

Section: Discussionmentioning

confidence: 99%

Elucidating the Role of Serum tRF-31-U5YKFN8DYDZDD as a Novel Diagnostic Biomarker in Gastric Cancer (GC)

Huang

Zhang

et al. 2021

Front. Oncol.

View full text Add to dashboard Cite

BackgroundGastric cancer (GC) is one of the malignant tumors with the highest morbidity and mortality in the world. Early diagnosis combined with surgical treatment can significantly improve the prognosis of patients. Therefore, it is urgent to seek higher sensitivity and specificity biomarkers in GC. tRNA-derived small RNAs are a new non-coding small RNA that widely exists in tumor cells and body fluids. In this study, we explore the expression and biological significance of tRNA-derived small RNAs in GC.Materials and MethodsFirst of all, we screened the differentially expressed tRNA-derived small RNAs in tumor tissues by high-throughput sequencing. Agarose gel electrophoresis (AGE), Sanger sequencing, and Nuclear and Cytoplasmic RNA Separation Assay were used to screen tRF-31-U5YKFN8DYDZDD as a potential tumor biomarker for the diagnosis of GC. Then, we detected the different expressions of tRF-31-U5YKFN8DYDZDD in 24 pairs of GC and paracancerous tissues, the serum of 111 GC patients at first diagnosis, 89 normal subjects, 48 superficial gastritis patients, and 28 postoperative GC patients by quantitative real-time PCR (qRT-PCR). Finally, we used the receiver operating characteristic (ROC) curve to analyze its diagnostic efficacy.ResultsThe expression of tRF-31-U5YKFN8DYDZDD has good stability and easy detection. tRF-31-U5YKFN8DYDZDD was highly expressed in tumor tissue, serum, and cell lines of GC, and the expression was significantly related to TNM stage, depth of tumor invasion, lymph node metastasis, and vascular invasion. The expression of serum tRF-31-U5YKFN8DYDZDD in the GC patients decreased after the operation (P = 0.0003). Combined with ROC curve analysis, tRF-31-U5YKFN8DYDZDD has better detection efficiency than conventional markers.ConclusionsThe expressions of tRF-31-U5YKFN8DYDZDD in the tumor and paracancerous tissues, the serum of GC patients and healthy people, and the serum of GC patients before and after operation were different. tRF-31-U5YKFN8DYDZDD is not only a diagnostic biomarker of GC but also a predictor of poor prognosis.

show abstract

Section: Discussionmentioning

confidence: 99%

Elucidating the Role of Serum tRF-31-U5YKFN8DYDZDD as a Novel Diagnostic Biomarker in Gastric Cancer (GC)

Huang

Zhang

et al. 2021

Front. Oncol.

View full text Add to dashboard Cite

show abstract

“…have revealed the expression pro le of tsRNAs in human colorectal cancer (CRC) specimens via sequencing analyses, and identi ed a speci c tsRNA derived from the internal of mature tRNA-His-GTG, 5'tiRNA-His-GTG (its base sequence is GCCGTGATCGTATAGTGGTTAGTACTCTGCGTTGT), which is up-regulated in CRC tissues [9]. Then, in vitro and in vivo experiments have revealed that inhibition of 5'tiRNA-His-GTG suppressed cancer cell proliferation and colony formation, induced cell apoptosis, and affected tumor growth in nude mice, these indicate that 5'tiRNA-His-GTG may act an oncogenic role in the progression of colorectal cancers [9]. In breast cancer, Mo et.al.…”

Section: Discussionmentioning

confidence: 99%

“…have identi ed the new class of tsRNAs derived from tRNA(Glu), tRNA(Asp), tRNA(Gly), and tRNA(Tyr) through hypoxic stress induction, this tsRNA fragments can bind and displace the 3'UTRs of YBX1 gene, which encoded a RNA-binding protein, then suppress the stability of multiple oncogenic transcripts such as EIF4EBP1 and AKT1, results in tumor-suppressive and metastasissuppressive activity in breast cancers [10]. Furthermore, in colorectal cancer cells, the upregulated 5'tiRNA-His-GTG is found to directly target LATS2, which is a key component of the hippo signaling pathway, and inhibits cell proliferation and promotes cell apoptosis by regulating YAP protein activity [9]. Our bioinformatics analyses displayed the interaction relationship of tRFdb-3013a/b and their predicted target genes, and found tRFdb-3013a/b could bind the 3'UTR of ST3GAL1, which is highly expressed in colon adenocarcinomas.…”

Section: Discussionmentioning

confidence: 99%

“…Subsequent efforts attempted to classify and tabulate the tsRNAs that were being discovered in some higher organisms into a curated repository, and structured the tRFdb database [8]. Several studies have linked the tsRNAs to different human cancers, including colorectal [9], liver, and breast cancer [10], etc. Growing evidences demonstrated that many tsRNAs were differentially expressed in the tissues of multiple cancer patients, these dysregulated tsRNA fragments might serve as potential candidates for diagnostic and prognostic biomarkers, and even contribute to various biological processes of cancer development and progression [11].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

The tsRNAs (tRFdb-3013a and tRFdb-3013b) Serve as Novel Biomarkers for Colon Adenocarcinomas

Wu¹,

Tan²,

Tang³

et al. 2021

Preprint

View full text Add to dashboard Cite

Background: Postoperative ileus is one of the most common complications after diverting loop ileostomy closure. Some reports have investigated the risk factors for postoperative complications or ileus after ileostomy closure; however, these studies did not evaluate the index surgery sufficiently. In this study, we evaluated the risk factors, including the details of the index surgery, for ileus after diverting ileostomy closure.Methods: This was a retrospective study of patients who underwent ileostomy closure following index surgery for rectal cancer. Patients who developed postoperative ileus (POI (+)) and patients who did not (POI (−)) after ileostomy closure were compared.Results: Fifty-nine patients were evaluated and were divided into two groups: POI (+) (n=9) and POI (−) (n=50), and the groups were compared. There were no significant differences in the details of the index surgery, operative procedure, transanal total mesorectal excision, lateral lymph node dissection, operating time, or blood loss. The incidence of Clavien–Dindo grade ≥ III complications after the index surgery was significantly higher in the POI (+) group. Conclusions: The incidence of Clavien–Dindo grade ≥ III complications after the index surgery may increase the risk of postoperative ileus after ileostomy closure.

show abstract

Section: Introductionmentioning

confidence: 99%

The tsRNAs (tRFdb-3013a And tRFdb-3013b) Serve As Novel Biomarkers For Colon Adenocarcinomas

Tan

Tang

et al. 2021

Preprint

View full text Add to dashboard Cite

Background: The tsRNAs (tRNA-derived small RNAs) are novel class of small non-coding RNAs derived from transfer-RNAs. Colon adenocarcinoma (COAD) are well known malignant intestinal tumors. This study focused on the identification and characterization of tsRNA biomarkers in colon adenocarcinomas. Methods: Data processing, bioinformatic analysis and visualization were performed with R or Python software. The cell proliferation, migration and invasion ability were described by CCK-8 and transwell assays. Luciferase reporter assays were performed to test the binding of tsRNA with its target.Results: With computational approaches, we identified the tsRNA fragments profiles within COAD datasets, and discriminated forty-two differentially expressed tsRNAs between colon adenocarcinomas and non-tumor controls. Among the fragments derived from the 3′ end of mature tRNA-His-GUG (a histidyl-transfer-RNA), tRFdb-3013a and tRFdb-3013b (tRFdb-3013a/b) were significantly decreased in colon adenocarcinomas, especially, tRFdb-3013a/b may tend to down-regulated in the patients with lymphatic or vascular invasion present. The clinical survival of colon adenocarcinomas patients with low tRFdb-3013a/b expression was significantly worse than that of high expression patients. In colon adenocarcinoma cells, tRFdb-3013a could suppressed cell proliferation, and reduced cell migration and invasion ability. The enrichment analyses showed that most of tRFdb-3013a-related genes were enriched in the extracellular matrix associated GO terms, phagosome pathway, and a GSEA molecular signature. Mechanically, the 3′UTR of ST3GAL1 mRNA was predicted to contain the putative binding sites of tRFdb-3013a/b, tRFdb-3013a/b might directly target ST3GAL1 and regulate ST3GAL1 expression in colon adenocarcinomas. Conclusions: These results suggested that tRFdb-3013a and tRFdb-3013b might serve as novel biomarkers for diagnosis and prognosis of colon adenocarcinomas, and play an important role in tumor progression of colon adenocarcinomas.

show abstract

A specific tRNA half, 5’tiRNA-His-GTG, responds to hypoxia via the HIF1α/ANG axis and promotes colorectal cancer progression by regulating LATS2

Cited by 85 publications

References 62 publications

Elucidating the Role of Serum tRF-31-U5YKFN8DYDZDD as a Novel Diagnostic Biomarker in Gastric Cancer (GC)

Elucidating the Role of Serum tRF-31-U5YKFN8DYDZDD as a Novel Diagnostic Biomarker in Gastric Cancer (GC)

The tsRNAs (tRFdb-3013a and tRFdb-3013b) Serve as Novel Biomarkers for Colon Adenocarcinomas

The tsRNAs (tRFdb-3013a And tRFdb-3013b) Serve As Novel Biomarkers For Colon Adenocarcinomas

Contact Info

Product

Resources

About