A Tn7-based broad-range bacterial cloning and expression system

Abstract

For many bacteria, cloning and expression systems are either scarce or nonexistent. We constructed several mini-Tn7 vectors and evaluated their potential as broad-range cloning and expression systems. In bacteria with a single chromosome, including Pseudomonas aeruginosa, Pseudomonas putida and Yersinia pestis, and in the presence of a helper plasmid encoding the site-specific transposition pathway, site- and orientation-specific Tn7 insertions occurred at a single attTn7 site downstream of the glmS gene. Burkholderia thailandensis contains two chromosomes, each containing a glmS gene and an attTn7 site. The Tn7 system allows engineering of diverse genetic traits into bacteria, as demonstrated by complementing a biofilm-growth defect of P. aeruginosa, establishing expression systems in P. aeruginosa and P. putida, and 'GFP-tagging' Y. pestis. This system will thus have widespread biomedical and environmental applications, especially in environments where plasmids and antibiotic selection are not feasible, namely in plant and animal models or biofilms.

Genome‐wide identification of tolerance mechanisms toward p‐coumaric acid in Pseudomonas putida

“…P. putida KT2440::miniTn 7 ‐Gm:GFP and P. putida KT2440 Δ fcs ::miniTn 7 ‐Gm:GFP (Table 1) were constructed by transformation of plasmid pBK‐miniTn7‐gfp2 (Koch, Jensen, & Nybroe, 2001) as previously described (Choi, Kumar, & Schweizer, 2006), using plasmid pTNS2 (Choi et al, 2005) as a helper. The correct integration of the transposon was checked by colony PCR using primers Tn7‐GlmS and Tn7R109 (Table 2).…”

mini-Tn7 insertion in bacteria with secondary, non-glmS-linked attTn7 sites: example Proteus mirabilis HI4320

“…The mini-Tn7 system greatly expands the arsenal of genetic tools for P. mirabilis, and currently available vectors facilitate single-copy gene cloning and complementation and tagging with GFP. By subcloning the respective inserts of existing plasmids 7 into a suicide delivery vector with an R6K origin of replication, additional vectors can be easily derived for regulated expression from the E. coli tac promoter, isolation of transcriptional or translational b-galactosidase (lacZ) fusions, and transcriptional bacterial luciferase (lux) fusions. Table 1 lists currently available mini-Tn7 vectors for use with P. mirabilis and includes tips for choosing the appropriate vectors for specific purposes.…”

Transcription factor levels enable metabolic diversification of single cells of environmental bacteria

“…XylR levels and metabolic diversification of P. putida R Guantes et al employed as conjugative helper in four-parental matings, as previously described (Choi et al, 2005;. All E. coli strains were grown at 37°C in Luria Bertani (LB) medium supplemented when required with gentamicin (Gm, 10 μg ml − 1 ), kanamycin (Km, 50 μg ml − 1 ), cloramphenicol (Cm, 30 μg ml − 1 ), streptomycin (Sm, 50 μg ml − 1 ) and ampicillin (Ap, 50 μg ml − 1 ).…”

“…This target strain is a plasmid-less P. putida KT2440 specimen bearing a chromosomal Pu-GFP fusion inserted with a mini-Tn5 transposon vector (de Lorenzo et al, 1990;Martínez-García et al, 2011;. To verify the correct insertion of mini-Tn7 [L-Gm lacI q /Ptrc → xylR-R] into the att locus of P. putida [Pu-GFP] we selected some Gm R clones amplified diagnostic segments by PCR using primer combinations 5-Pput-glmS UP (5′AGTCAGAGTTACGGAATTGT AGG3′) with 3-Tn7L (5′ATTAGCTTACGACGCTAC ACCC3′) and 5-PpuglmS DOWN (5′TTACGTGG CCG TGCTAAAGGG3′) with 3-Tn7R (5′CACAGC ATA ACTGGACTGATTTC3′) and the products of amplification having a size of 400 and 200bp, respectively (Schweizer, 2001;Choi et al, 2005;Choi and Schweizer, 2006). One of the clones with the correct banding patterns was then named P. putida KT-IB1 and employed as required.…”