A very compact mt-DNA control region in the widely distributed goby Pomatoschistus minutus (Teleostei: Gobiidae)

Abstract

The control region of the mitochondrial genome was amplified and sequenced for six individuals of the gobioid fish Pomatoschistus minutus, from several European localities, and one specimen of the related Deltentosteus quadrimaculatus. The length of this region for the former species was found to be 773 bp, 7·1% shorter than that previously described as the most compact D-loop known among teleosts. Sequences from other fish have been compared and the largest gap falls in the section between the conserved sequence block and the pyrimidine tract. Alignment of P. minutus sequences was done with D. quadrimaculatus, whose control region length was 853 bp, and this gap was found to be of 61 bp. For the P. minutus sample, the intraspecific sequence divergence is 0·07%.

High gene flow promotes the genetic homogeneity of the fish goby Pomatoschistus marmoratus (Risso, 1810) from Mar Menor coastal lagoon and adjacent marine waters (Spain)

“…1989). A fragment of the control region of mitochondrial DNA was amplified using primers UG‐PROA (5′‐AACTCCCRCCCCTGGYYCCCAAAGCCAGCATTC‐3′) and MIN‐FB (5′‐TCAAAATTGATGGTAAAGTCAGGAC‐3′) (Stefanni et al. 2002).…”

“…The tissue was dissolved using lysis buffer solution with proteinase K, and total genomic DNA was isolated by protein precipitation and final precipitation with ethanol (Sambrook et al 1989). A fragment of the control region of mitochondrial DNA was amplified using primers UG-PROA (5¢-AA-CTCCCRCCCCTGGYYCCCAAAGCCAGCATTC-3¢) and MIN-FB (5¢-TCAAAATTGATGGTAAAGTCAGGAC-3¢) (Stefanni et al 2002). A double-stranded DNA of D-loop was PCR synthesized in 25-ll reactions containing 2.5 ll amplification buffer (10·), 2.5 ll each of the above primers (10 lm), 1.0 ll MgCl 2 (50 mm), 0.5 ll of dNTP mix (25 mm) and 1 U Taq polymerase (Ecogen), 1 ll DNA and purified water to complete the final volume.…”

“…(ii) Is the genetic diversity higher in ecologically variable lagoon populations? To find answers to these questions, the genetic variation in the population of the sand goby Pomatoschistus marmoratus from the Mar Menor coastal lagoon (SW Spain) and adjacent marine locations was investigated using mitochondrial DNA control region sequences, which have been demonstrated to be informative for population level studies in other Pomatoschistus species (Stefanni et al. 2002; Stefanni & Thorley 2003).…”