A YAC contig map of <i>Arabidopsis thaliana</i> chromosome 3

Camilleri, Christine; Lafleuriel, J.; Macadré, Catherine; Varoquaux, Fabrice; Parmentier, Yves; Picard, Georges; Caboche, Michel; Bouchez, David

doi:10.1046/j.1365-313x.1998.00159.x

Cited by 59 publications

(28 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…A 13.5-kb plasmid (pEB8) containing 2.2 kb of plant DNA flanking the right border of the T-DNA was isolated. Using a polymerase chain reaction (PCR) primer pair designed from the rescued flanking DNA and PCR screening of the CIC yeast activation chromosome library, we localized this genomic region on yeast activation chromosome CIC11A1 anchored by the pCIT1210 and m339 markers at the bottom of chromosome 3 (Camilleri et al, 1998). The molecular mapping data for tt12 thus confirmed the genetic mapping using morphological markers (Figure 4).…”

supporting

confidence: 55%

See 1 more Smart Citation

The TRANSPARENT TESTA12 Gene of Arabidopsis Encodes a Multidrug Secondary Transporter-like Protein Required for Flavonoid Sequestration in Vacuoles of the Seed Coat Endothelium

et al. 2001

View full text Add to dashboard Cite

Phenolic compounds that are present in the testa interfere with the physiology of seed dormancy and germination. We isolated a recessive Arabidopsis mutant with pale brown seeds, transparent testa12 ( tt12 ), from a reduced seed dormancy screen. Microscopic analysis of tt12 developing and mature testas revealed a strong reduction of proanthocyanidin deposition in vacuoles of endothelial cells. Double mutants with tt12 and other testa pigmentation mutants were constructed, and their phenotypes confirmed that tt12 was affected at the level of the flavonoid biosynthetic pathway. The TT12 gene was cloned and found to encode a protein with similarity to prokaryotic and eukaryotic secondary transporters with 12 transmembrane segments, belonging to the MATE (multidrug and toxic compound extrusion) family. TT12 is expressed specifically in ovules and developing seeds. In situ hybridization localized its transcript in the endothelium layer, as expected from the effect of the tt12 mutation on testa flavonoid pigmentation. The phenotype of the mutant and the nature of the gene suggest that TT12 may control the vacuolar sequestration of flavonoids in the seed coat endothelium. INTRODUCTIONFlavonoids represent a highly diverse group of plant aromatic secondary metabolites. The major forms, which are anthocyanins (red to purple pigments), flavonols (colorless to pale yellow pigments), and proanthocyanidins (PAs), also known as condensed tannins (colorless pigments that brown with oxidation), are present in proportions and amounts that vary according to the plant species, the organ, the stage of development, and environmental growth conditions. Arabidopsis contains flavonoid pigments in vegetative tissues and in seeds (Shirley et al., 1995). In the mature testa, flavonoids were detected in both the endothelium and the three crushed parenchymal layers just above the endothelium . PAs have been shown to accumulate exclusively in the endothelium layer (Devic et al., 1999). Wild-type seed color depends on the stage of development: as long as the testa is transparent, until ‫ف‬ 10 days after pollination, the seed has the color of the underlying endosperm and embryo. At maturity, the testa becomes opaque after the oxidation of flavonoid pigments, which gives the seed its characteristic brown color. Therefore, the color of mutants with seed flavonoid defects ranges from pale yellow (complete lack of visible pigments in the testa) to pale brown, depending on the accumulated intermediate flavonoids .In Arabidopsis, mutants at 21 loci have been isolated on the basis of altered testa pigmentation (Figure 1). The genes disrupted in the transparent testa ( tt ) mutants tt3 , tt4 , tt5 , tt6 , and tt7 (Shirley et al., 1995) and the banyuls ( ban ) mutant (Albert et al., 1997) code for the enzymes dihydroflavonol-4-reductase (Shirley et al., 1992), chalcone synthase (Feinbaum and Ausubel, 1988), chalcone isomerase (Shirley et al., 1992), flavonol 3-hydroxylase (Pelletier and Shirley, 1996; Wisman et al., 1998), flavonol 3 Ј -hydroxylase (Ko...

show abstract

supporting

confidence: 55%

“…The other marker positions are deduced from our own linkage data combined with the genetic map described by Koornneef (1994). The position of tt6 to the left of tt5 was deduced from the molecular mapping data of Camilleri et al (1998). …”

mentioning

confidence: 99%

The TRANSPARENT TESTA12 Gene of Arabidopsis Encodes a Multidrug Secondary Transporter-like Protein Required for Flavonoid Sequestration in Vacuoles of the Seed Coat Endothelium

et al. 2001

View full text Add to dashboard Cite

show abstract

“…The Arabidopsis thaliana Columbia ecotype possesses 5S rDNA loci in the pericentromeric region of chromosomes 3, 4, and 5 (Murata et al 1997;Camilleri et al 1998;Fransz et al 1998;Schmidt et al 1995;Tutois et al 1999 and Fig. 1) for a total of ∼1000 5S rDNA genes.…”

Section: Resultsmentioning

confidence: 99%

Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

Cloix¹,

Tutois²,

Yukawa³

et al. 2001

Genome Res.

Self Cite

View full text Add to dashboard Cite

One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5Ј-and 3Ј-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

show abstract

“…For mapping analysis, we used the previously described cleaved amplified polymorphic sequence markers GapC, GL1, ASA1, NCC1, GPA1, DFR, and g8300 (Konieczny and Ausubel, 1993;Cherry et al, 1998) and the microsatellite markers nga6, nga8, and nga280 (Bell and Ecker, 1994). We also designed a new cleaved amplified polymorphic sequence marker for this analysis from the marker PRC6(a) (accession number X66825) located at the bottom of chromosome III between GL1 and nga6 (Camilleri et al, 1998). We amplified a 2-kb fragment with the primers GAAAAAGGTAAAAGAATGGCGAG and ACGGTAAGTTACACAATGAGA and digested it with SstI.…”

Section: Genetic Analysesmentioning

confidence: 99%

sas1, an Arabidopsis Mutant Overaccumulating Sodium in the Shoot, Shows Deficiency in the Control of the Root Radial Transport of Sodium

et al. 2001

View full text Add to dashboard Cite

A recessive mutation of Arabidopsis designated sas1 (for sodium overaccumulation in shoot) that was mapped to the bottom of chromosome III resulted in a two-to sevenfold overaccumulation of Na ؉ in shoots compared with wild-type plants. sas1 is a pleiotropic mutation that also caused severe growth reduction. The impact of NaCl stress on growth was similar for sas1 and wild-type plants; however, with regard to survival, sas1 plants displayed increased sensitivity to NaCl and LiCl treatments compared with wild-type plants. sas1 mutants overaccumulated Na ؉ and its toxic structural analog Li ؉ , but not K ؉ , Mg 2 ؉ , or Ca 2 ؉ . Sodium accumulated preferentially over K ؉ in a similar manner for sas1 and wild-type plants. Sodium overaccumulation occurred in all of the aerial organs of intact sas1 plants but not in roots. Sodium-treated leaf fragments or calli displayed similar Na ؉ accumulation levels for sas1 and wild-type tissues. This suggested that the sas1 mutation impaired Na ؉ long-distance transport from roots to shoots. The transpiration stream was similar in sas1 and wild-type plants, whereas the Na ؉ concentration in the xylem sap of sas1 plants was 5.5-fold higher than that of wild-type plants. These results suggest that the sas1 mutation disrupts control of the radial transport of Na ؉ from the soil solution to the xylem vessels. INTRODUCTIONAmong abiotic stresses, salinity is one of the major causes of yield losses of crop plants (Boyer, 1982). Salt stress is a polymorphous stress that reduces yield through three direct effects: osmotic stress, nutritional stress, and ion toxicity. It is widely thought that breeding for salt tolerance will involve developing a pyramiding strategy for selecting favorable combinations of traits, each of which would improve one of the physiological adaptations to salt stress (Yeo and Flowers, 1986). However, it is not clear which traits are appropriate for use in breeding programs to improve salt tolerance. Many physiological and molecular responses to salinity have been described (Greenway and Munns, 1980;Munns, 1993;Yeo, 1998), but their effects on the improvement of salt tolerance have seldom been demonstrated. This observation made clear the necessity of developing genetic approaches to establish which responses are physiologically relevant to salt tolerance (Epstein et al., 1980).The contributions of different physiological responses to salt tolerance were analyzed recently in genetic studies with a number of different variants (mutants or transgenic plants). The advantages of using mutants are that no prior knowledge of the molecular bases of the mechanism of interest is necessary and that mutants can reveal mechanisms previously unknown to be involved in salt tolerance. The identification and characterization of salt-tolerant and salt-hypersensitive mutants have drawn attention to several matters: (1) the control of Cl Ϫ transport from root to shoot (Abel, 1969); (2) the overaccumulation of proline (Kueh and Bright, 1982); (3) the overaccumulation of Na ϩ and K ϩ ...

show abstract

A YAC contig map of Arabidopsis thaliana chromosome 3

Cited by 59 publications

References 54 publications

The TRANSPARENT TESTA12 Gene of Arabidopsis Encodes a Multidrug Secondary Transporter-like Protein Required for Flavonoid Sequestration in Vacuoles of the Seed Coat Endothelium

The TRANSPARENT TESTA12 Gene of Arabidopsis Encodes a Multidrug Secondary Transporter-like Protein Required for Flavonoid Sequestration in Vacuoles of the Seed Coat Endothelium

Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

sas1, an Arabidopsis Mutant Overaccumulating Sodium in the Shoot, Shows Deficiency in the Control of the Root Radial Transport of Sodium

Contact Info

Product

Resources

About