Achromobacter xylosoxidans Infection Presenting as a Pulmonary Nodule Mimicking Cancer

Claassen, Stephanie L.; Reese, Jason M.; Mysliwiec, Vincent; Mahlen, Steven D.

doi:10.1128/jcm.02571-10

Cited by 22 publications

(28 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Three sets of primers (VB1 to VB6) were used to amplify the 1,500-bp 16S rRNA gene, and the first set (VB1 and VB2) was used for the 500-bp 16S rRNA sequencing. The primers were as follows: VB1 (TGGAGAGTTTGATCCTG GCTCAG), VB2 (TACCGCGGCTGCTGGCAC), VB3 (CCAGCAGCCG CGGTAATAC), VB4 (CGGGACTTAACCCAACATCTCAC), VB5 (GTG AGATGTTGGGTTAAGTCCCG), and VB6 (AAGGAGGTGATCCAGCC GCA) (15,16). The sequences were analyzed and compared to information in the BIBI and GenBank databases (17).…”

Section: Methodsmentioning

confidence: 99%

Identification and Clinical Significance of Helcococcus species, with Description of Helcococcus seattlensis sp. nov. from a Patient with Urosepsis

Chow

Clarridge

2014

J Clin Microbiol

View full text Add to dashboard Cite

Helcococcus spp. are Gram-positive, catalase-negative, facultatively anaerobic cocci that are associated with wound and prosthetic joint infections as well bacteremia and empyema. Five Helcococcus spp. strains were isolated from our patient population, including 2 strains of Helcococcus kunzii from trauma-associated wounds, 2 Helcococcus sueciensis strains from blood and abscess, and a novel Helcococcus spp. strain from blood associated with urosepsis. Based on the phenotypic and phylogenetic evidence, we propose that the unknown bacterium be classified as Helcococcus seattlensis sp. nov. We found that all 5 tested Helcococcus strains grew as satellite colonies around Staphylococcus aureus and, interestingly, both H. kunzii strains were isolated together with S. aureus. In addition to 16S rRNA gene sequencing, conventional methods for leucine aminopeptidase (LAP) and pyrrolidonyl arylamidase (PYR) testing can be cost-effective and efficient for differentiation of Helcococcus spp. from Abiotrophia and Granulicatella species. Using nonstandard methods, we found that all tested Helcococcus spp. had high MICs of >4/76 g/ml for trimethoprim-sulfamethoxazole, an antibiotic commonly used to treat urinary tract infections. High MICs for erythromycin, azithromycin, and clindamycin, and intermediate to high MICs for moxifloxacin, levofloxacin, and gentamicin were also observed among the Helcococcus strains.

show abstract

Section: Methodsmentioning

confidence: 99%

Identification and Clinical Significance of Helcococcus species, with Description of Helcococcus seattlensis sp. nov. from a Patient with Urosepsis

Chow

Clarridge

2014

J Clin Microbiol

View full text Add to dashboard Cite

show abstract

“…The second most common was non-cystic fibrosis bronchiectasis (15% of cases). In perhaps the best review to date of achromobacterial lung disease in subjects with and without cystic fibrosis, Claasen and colleagues (11) found that the most common comorbidities affecting subjects without cystic fibrosis were malignancies (solid and hematologic) and immunoglobulin deficiencies. These findings parallel earlier work on Achromobacter bacteremia, which found higher prevalence rates among immunosuppressed subjects and those with underlying malignancy (10,19,55).…”

Section: Comorbiditiesmentioning

confidence: 98%

“…However, certain species, most notably xylosoxidans and denitrificans, can cause disease in certain patient populations, such as subjects with cystic fibrosis, hematologic and solid organ malignancies, renal failure, and immunodeficiencies (8)(9)(10)(11)(12). The most frequent clinical isolate is xylosoxidans, which can infect any number of organ systems, and is increasingly recognized as an important emerging nosocomial pathogen (13)(14)(15)(16)(17)(18)(19).…”

mentioning

confidence: 98%

Achromobacter Respiratory Infections

Swenson

Sadikot²

2015

Annals ATS

106

View full text Add to dashboard Cite

Achromobacteria are ubiquitous environmental organisms that may also become opportunistic pathogens in certain conditions, such as cystic fibrosis, hematologic and solid organ malignancies, renal failure, and certain immune deficiencies. Some members of this genus, such as xylosoxidans, cause primarily nosocomially acquired infections affecting multiple organ systems, including the respiratory tract, urinary tract, and, less commonly, the cardiovascular and central nervous systems. Despite an increasing number of published case reports and literature reviews suggesting a global increase in achromobacterial disease, most clinicians remain uncertain of the organism's significance when clinically isolated. Moreover, effective treatment can be challenging due to the organism's inherent and acquired multidrug resistance patterns. We reviewed all published cases to date of non-cystic fibrosis achromobacterial lung infections to better understand the organism's pathogenic potential and drug susceptibilities. We found that the majority of these cases were community acquired, typically presenting as pneumonias (88%), and were most frequent in individuals with hematologic and solid organ malignancies. Our findings also suggest that achromobacterial lung infections are difficult to treat, but respond well to extended-spectrum penicillins and cephalosporins, such as ticarcillin, piperacillin, and cefoperazone.

show abstract

“…34 , 35 It, like Burkholderia , has been isolated from aqueous solutions used in health-care facilities, including IV and dialysis solutions, and it can colonize medical equipment. 36 …”

Section: Th E Pathogensmentioning

confidence: 99%

Antimicrobial Resistance in Hospital-Acquired Gram-Negative Bacterial Infections

Mehrad

Clark

Zhanel

et al. 2015

Chest

185

138

View full text Add to dashboard Cite

Achromobacter xylosoxidans Infection Presenting as a Pulmonary Nodule Mimicking Cancer

Cited by 22 publications

References 41 publications

Identification and Clinical Significance of Helcococcus species, with Description of Helcococcus seattlensis sp. nov. from a Patient with Urosepsis

Identification and Clinical Significance of Helcococcus species, with Description of Helcococcus seattlensis sp. nov. from a Patient with Urosepsis

Achromobacter Respiratory Infections

Antimicrobial Resistance in Hospital-Acquired Gram-Negative Bacterial Infections

Contact Info

Product

Resources

About