Activin A Promotes Neuronal Differentiation of Cerebrocortical Neural Progenitor Cells

Abstract

BackgroundActivin A is a protein that participates principally in reproductive functions. In the adult brain, Activin is neuroprotective, but its role in brain development is still elusive.Methodology/Principal FindingsWe studied if Activin A influences proliferation, differentiation or survival in rat cerebrocortical neural progenitor cells (NPC). After stimulation of NPC with Activin A, phosphorylation and nuclear translocation of Smad 2/3 were induced. In proliferating NPC, Activin produced a significant decrease in cell area and also a discrete increase in the number of neurons in the presence of the mitogen Fibroblast Growth Factor 2. The percentages of cells incorporating BrdU, or positive for the undifferentiated NPC markers Nestin and Sox2, were unchanged after incubation with Activin. In differentiating conditions, continuous treatment with Activin A significantly increased the number of neurons without affecting astroglial differentiation or causing apoptotic death. In cells cultured by extended periods, Activin treatment produced further increases in the proportion of neurons, excluding premature cell cycle exit. In clonal assays, Activin significantly increased neuronal numbers per colony, supporting an instructive role. Activin-induced neurogenesis was dependent on activation of its receptors, since incubation with the type I receptor inhibitor SB431542 or the ligand-trap Follistatin prevented neuronal differentiation. Interestingly, SB431542 or Follistatin by themselves abolished neurogenesis and increased astrogliogenesis, to a similar extent to that induced by Bone Morphogenetic Protein (BMP)4. Co-incubation of these Activin inhibitors with the BMP antagonist Dorsomorphin restored neuronal and astrocytic differentiation to control levels.ConclusionsOur results show an instructive neuronal effect of Activin A in cortical NPC in vitro, pointing out to a relevant role of this cytokine in the specification of NPC towards a neuronal phenotype.

Transgenic GDNF Positively Influences Proliferation, Differentiation, Maturation and Survival of Motor Neurons Produced from Mouse Embryonic Stem Cells

“…Primers (all in 5′→3′) for GAPDH were: Forward, ATCACCATCTTCCAGGAGCG and Reverse, CCTGCTTCACCACCTTCTTG and for transgenic hGDNF: Forward, AACAAATGGCAGTGCTTCCT and Reverse, AGCCGCTGCAGTACCTAAAA. The same protocol and primers were used for mRNA using Trizol extraction protocol after DNase treatment (López-González et al, 2011 ; Rodríguez-Martínez et al, 2012 ).…”

“…Total RNA was isolated from CTRL- and GDNF-ESC. Reverse transcription was performed with random hexamers to produce cDNA, as previously reported (Rodríguez-Martínez et al, 2012 ). The following primers were used to perform qPCR, starting with 100 ng of cDNA: Oct4 : Forward (Fwd), TTG GGC TAG AGA AGG ATG TGG TT; Reverse (Rev), GGA AAA GGG ACT GAG TAG AGT GTG G. For Sox2 : Fwd, GCA CAT GAA CGG CTG GAG CAA CG; Rev, TGC TGC GAG TAG GAC ATG CTG TAG G. For Nanog : Fwd, TAT CTG GTG AAC GCA TCT GG and Rev, GAA GTT ATG GAG CGG AGC AG.…”

Therapeutic advances for blocking heterotopic ossification in fibrodysplasia ossificans progressiva

“…Furthermore, multiple studies have established that activin A is a critical regulator of inflammation and immunity both systemically and in specific tissues such as the lung . There is also evidence that activin A plays a role in neuronal differentiation . The potential effects of activin A inhibition in these tissues, and the effects on inflammation and immune response, must be carefully monitored.…”

Use of Early Biomarkers in Neonatal Brain Damage and Sepsis: State of the Art and Future Perspectives

“…Activin A is a member of the TGF-beta superfamily and is made up by two βα subunits [ 38 ]. Activin A promotes neuronal differentiation [ 39 ], its receptors are highly expressed in neuronal cells, and neuronal activity upregulates activin mRNA expression [ 40 ]. It was originally purified from gonadal fluids as a protein enhancing the pituitary follicle stimulating hormone release.…”