Adaptive selection at agouti gene inferred breed specific selection signature within the indigenous goat populations

Ahmad, Hafiz Ishfaq; Liu, Guiqiong; Jiang, Xunping; Liu, Chenhui; Xu, Fangzheng; Chong, Yuqing; Ijaz, Nabeel; Huang, Huarong

doi:10.5713/ajas.16.0994

Cited by 12 publications

(17 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The variability between Ka and Ks polymorphisms at the allelic distribution level presents quite an explicit proof for positive selection [30]. The allelic distribution in various coding sites can be revealed by the strapping test of neutrality, which is applicable to genomic data containing a large number of polymorphisms, along with the homogeneity test allow for comparing the frequency distribution of synonymous sites [3,46]. The changes in the coding region during the evolutionary time under analysis showed the cumulative presence of synonymous, non-synonymous and ambiguous (indels) codons (Additional file 3: Figure S1).…”

Section: Positive and Purifying Selection Of Bahd Genes In Soybeanmentioning

confidence: 99%

“…Ambiguities in the posterior gene-and site-specific distributions were calculated through FUBAR using the MCMC approach [3,54]. This analysis revealed the following number of sites in BAHD genes under pervasive diversifying selection: one site in clade I, four in clades II and III each, and two in clade IV (Additional file 2: Table S4).…”

Section: Positive and Purifying Selection Of Bahd Genes In Soybeanmentioning

confidence: 99%

See 1 more Smart Citation

Global dissection of the BAHD acyltransferase gene family in soybean: Expression profiling, metabolic functions, and evolution

Ahmad¹,

Zeng²,

Dong³

et al. 2020

Preprint

View full text Add to dashboard Cite

Background: Members of the BAHD acyltransferase (ACT) family play important roles in plant defence against biotic and abiotic stresses. Previous genome-wide studies explored different acyltransferase gene families, but not a single study was found so far on the overall genome-wide or positive selection analyses of the BAHD family genes in Glycine max . A better understanding of the functions that specific members of this family play in stress defence can lead to better breeding strategies for stress tolerance. Results: A total of 103 genes of the BAHD family (GmACT genes) were mined from the soybean genome, which could be grouped into four phylogenetic clades (I- IV). Clade III was further divided into two sub-clades (IIIA and IIIB). In each clade, the constituent part of the gene structures and motifs were relatively conserved. These 103 genes were distributed unequally on all 20 chromosomes, and 16 paralogous pairs were found within the family. Positive selection analysis revealed important amino acids under strong positive selection, which suggests that the evolution of this gene family modulated soybean domestication. Most of the expression of ACT genes in soybean was repressed with Al 3+ and fungal elicitor exposure, except for GmACT84 , which expression increased in these conditions 2- and 3-fold, respectively. The promoter region of GmACT84 contains the maximum number of stress-responsive elements among all GmACT genes and is especially enriched in MYB-related elements. Some GmACT genes showed expression specific under specific conditions, while others showed constitutive expression in all soybean tissues or conditions analysed. Conclusions: This study provided a genome-wide analysis of the BAHD gene family and assessed their expression profiles. We found evidence of a strong positive selection of GmACT genes. Our findings will help efforts of functional characterisation of ACT genes in soybean in order to discover their involvement in growth, development, and defence mechanisms.

show abstract

Section: Positive and Purifying Selection Of Bahd Genes In Soybeanmentioning

confidence: 99%

Section: Positive and Purifying Selection Of Bahd Genes In Soybeanmentioning

confidence: 99%

Global dissection of the BAHD acyltransferase gene family in soybean: Expression profiling, metabolic functions, and evolution

Ahmad¹,

Zeng²,

Dong³

et al. 2020

Preprint

View full text Add to dashboard Cite

show abstract

“…According to the standards of polymorphism information content, these four Chinese yellow cattle breeds had intermediate polymorphism information. That is to say, the genetic variation in this site is abundant, which could have a pronounced effect on selective breeding Ahmad et al, 2017). The genotypic distribution of QC cattle, LX cattle, and JX cattle was not in Hardy-Weinberg equilibrium (HWE) (P > 0.05).…”

Section: Discussionmentioning

confidence: 97%

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

Zhao

Wang

et al. 2018

Arch. Anim. Breed.

View full text Add to dashboard Cite

Abstract. During the past decades, insertions and deletions (indels) have become increasingly popular in animal breeding for understanding the relationship between genotypes and phenotypes. The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect their effects on growth traits in four breeds of Chinese yellow cattle. Herein, we first confirmed a novel 24 bp indel (AC_000187.1g.4187270-4187293delAATTTATTGGGAGATTATTGAATT) within the intron of the cattle AR gene. This is consistent with the results predicted from the NCBI SNP database. The distribution of the indel genotypes of four Chinese yellow cattle were significantly different from each other (P < 0.01). After significant correlation analysis, many remarkable phenotypic differences among the three genotypes were found (P < 0.05).In conclusion, a novel 24 bp indel within the AR gene significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.

show abstract

“…Ambiguities in posterior gene-and site-specific distributions were calculated through FUBAR using the MCMC approach [71,72]. This analysis revealed the following number of sites in BAHD genes under pervasive diversifying selection: one site in clade I, four in clades II and III each, and two in clade IV (Additional file 2: Table S4).…”

Section: Positive and Purifying Selection Of Bahd Genes In Soybeanmentioning

confidence: 99%

“…Nucleotide and amino acid substitutions in the codon model were used to identify synonymous and nonsynonymous substitutions [71,73]. The genetic algorithm in the codon model evolution was used to identify the evolutionary fingerprint in coding sites of BAHD genes.…”

Section: The Evolutionary Fingerprint Of Soybean Bahd Genesmentioning

confidence: 99%

Global dissection of the BAHD acyltransferase gene family in soybean: Expression profiling, metabolic functions, and evolution

Ahmad

Zeng

Dong

et al. 2020

Preprint

View full text Add to dashboard Cite

Background: Members of the BAHD acyltransferase (ACT) family play important roles in plant defence against biotic and abiotic stresses. A better understanding of the functions that specific members of this family play in stress defence can lead to better breeding strategies for stress tolerance. Previous genome-wide studies explored other acyltransferase families, but so far not a single study has been published on genome-wide or positive selection analyses of the BAHD genes in Glycine max . Results: A total of 103 genes of the BAHD family (GmACT genes) were identified from the soybean genome, which could be grouped into four phylogenetic clades (I-IV). Clade III was further divided into two sub-clades (IIIA and IIIB). In each clade, the gene structure and functional motifs were relatively well conserved. These ACT genes were unequally distributed on all 20 chromosomes, and 16 paralogous pairs were found within the family. Positive selection analysis revealed amino acids under strong positive selection, which suggests that the evolution of this gene family modulated soybean domestication. Some GmACT genes showed expression specific under specific conditions, while others showed constitutive expression in all soybean tissues or conditions analysed. Most of the expression of ACT genes in soybean was repressed with Al 3+ and fungal elicitor exposure, except for GmACT84 , which expression increased in these conditions 2- and 3-fold, respectively. The promoter of GmACT84 contains the maximum number of stress-responsive elements among all GmACT genes and it is especially enriched in MYB-related elements. Conclusions: This study provides a genome-wide analysis of the BAHD gene family and assessed their expression profiles in soybean. We found evidence of a strong positive selection of GmACT genes. Our findings will help efforts of functional characterisation of ACT genes in soybean in order to discover their involvement in growth, development, and defence mechanisms.

show abstract

Adaptive selection at agouti gene inferred breed specific selection signature within the indigenous goat populations

Abstract: This study provides strong evidence of breed specific selection of the agouti gene within the indigenous goat breeds. We also demonstrate comprehensive approaches formulating systemic searches for genes; that have undergone positive selection in lineages.

Cited by 12 publications

References 0 publications

Global dissection of the BAHD acyltransferase gene family in soybean: Expression profiling, metabolic functions, and evolution

Global dissection of the BAHD acyltransferase gene family in soybean: Expression profiling, metabolic functions, and evolution

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

Global dissection of the BAHD acyltransferase gene family in soybean: Expression profiling, metabolic functions, and evolution

Contact Info

Product

Resources

About