Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

Abstract

Abstract. During the past decades, insertions and deletions (indels) have become increasingly popular in animal breeding for understanding the relationship between genotypes and phenotypes. The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect their effects on growth traits in four breeds of Chinese yellow cattle. Herein, we first confirmed a novel 24 bp indel (AC_000187.1g.4187270-4187293delAATTTATTGGGAGATTATTGAATT) within the intron of the cattle AR gene. This is consistent with the results predicted from the NCBI SNP database. The distribution of the indel genotypes of four Chinese yellow cattle were significantly different from each other (P < 0.01). After significant correlation analysis, many remarkable phenotypic differences among the three genotypes were found (P < 0.05).In conclusion, a novel 24 bp indel within the AR gene significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.

Functional Analysis of Haplotypes in Bovine PSAP Gene and Their Relationship with Beef Cattle Production Traits

“…Their morphological traits were measured, including body weight (BW), body height (BH), body length (BL), chest circumference (ChC), chest depth (ChD), chest width (ChW), hucklebone width (HuW), and hip width (HW). Genome DNA was extracted from the leukocytes of venous blood by the phenol chloroform method [ 16 , 20 ]. All DNA samples underwent quality assurance and were uniformly diluted to 50 ng/μL and stored at −80 °C [ 16 ].…”

“…Genome DNA was extracted from the leukocytes of venous blood by the phenol chloroform method [ 16 , 20 ]. All DNA samples underwent quality assurance and were uniformly diluted to 50 ng/μL and stored at −80 °C [ 16 ].…”

“…They are involved in the nervous system, collective oxidative stress, sperm fertilization, and other biological processes [ 15 ]. PSAP is reported to be the target gene of androgen receptor ( AR ), and a potential molecular marker was identified in AR in our previous studies [ 16 ]. At the same time, PSAP regulates caspase, mitogen-activated protein kinase (MAPK), phosphatidylinositol 3’-kinase/AKT serine/threonine kinase 1 (PI3K/Akt), and transforming growth factor-β (TGF-β) pathways and has an important relationship with animal growth and development [ 17 ].…”

Exploring insertions and deletions (indels) of &lt;i&gt;MSRB3&lt;/i&gt; gene and their association with growth traits in four Chinese indigenous cattle breeds

“…In order to demonstrate the relationship between polymorphisms and performance traits, more than 6000 growth traits were measured and calculated, including body weight (BW), body height (BH), body length (BL), chest circumference (ChC), chest depth (ChD), chest width (ChW), hucklebone width (HuW), hip width (HW), cannon circumference (CaC), body length index (BLI), chest circumference index (ChCI), chest width index (ChWI), cannon circumference index (CaCI), hucklebone width index (HuWI), and trunk index (TI) (Zhang et al, 2019;. All data were measured by the same person following the same standard (Zhao et al, 2018).…”

“…The amplification conditions of PCR were listed as follows: denaturing at 95 • C for 5 min followed by 35 cycles of 95 • C for 30 s, annealing for 30 s, and extending at 72 • C for 30 s followed by final extension at 72 • C for 10 min. PCR products were sequenced directly (Shanghai Sangon Biotech Co., Ltd., P. R. China) to identify potential mutation sites (Zhao et al, 2018). For the confirmed indel loci, every sample was amplified by the aforementioned PCR system and genotyped by 10 % PAGE (polyacrylamide gel electrophoresis) (Pu et al, 2014).…”