ADMP controls the size of Spemann's organizer through a network of self-regulating expansion-restriction signals

Abstract

BackgroundThe bone morphogenetic protein (BMP) signaling gradient is central for dorsoventral patterning in amphibian embryos. This gradient is established through the interaction of several BMPs and BMP antagonists and modulators, some secreted by Spemann's organizer, a cluster of cells coordinating embryonic development. Anti-dorsalizing morphogenetic protein (ADMP), a BMP-like transforming growth factor beta ligand, negatively affects the formation of the organizer, although it is robustly expressed within the organizer itself. Previously, we proposed that this apparent discrepancy may be important for the ability of ADMP to scale the BMP gradient with embryo size, but how this is achieved is unclear.ResultsHere we report that ADMP acts in the establishment of the organizer via temporally and mechanistically distinct signals. At the onset of gastrulation, ADMP is required to establish normal organizer-specific gene expression domains, thus displaying a dorsal, organizer-promoting function. The organizer-restricting, BMP-like function of ADMP becomes apparent slightly later, from mid-gastrula. The organizer-promoting signal of ADMP is mediated by the activin A type I receptor, ACVR1 (also known as activin receptor-like kinase-2, ALK2). ALK2 is expressed in the organizer and is required for organizer establishment. The anti-organizer function of ADMP is mediated by ACVRL1 (ALK1), a putative ADMP receptor expressed in the lateral regions flanking the organizer that blocks expansion of the organizer. Truncated ALK1 prevents the organizer-restricting effects of ADMP overexpression, suggesting a ligand-receptor interaction. We also present a mathematical model of the regulatory network controlling the size of the organizer.ConclusionsWe show that the opposed, organizer-promoting and organizer-restricting roles of ADMP are mediated by different receptors. A self-regulating network is proposed in which ADMP functions early through ALK2 to expand its own expression domain, the organizer, and later functions through ALK1 to restrict this domain. These effects are dependent on ADMP concentration, timing, and the spatial localization of the two receptors. This self-regulating temporal switch may control the size of the organizer and the genes expressed within in response to genetic and external stimuli during gastrulation.Electronic supplementary materialThe online version of this article (10.1186/s12915-018-0483-x) contains supplementary material, which is available to authorized users.

Striking parallels between dorsoventral patterning in Drosophila and Gryllus reveal a complex evolutionary history behind a model gene regulatory network

“…Like Tribolium , Gryllus possesses a homolog of BMP9, a ligand whose function has only been characterised in vertebrates so far. Like Nasonia , Gryllus possesses a homolog of ADMP, a BMP-like ligand that is involved in size regulation during early DV axis formation in vertebrates ( Leibovich et al, 2018 ). Interestingly, unlike any other insect studied so far Gryllus possess a homolog of BMP3, a ligand with inhibitory effects on BMP signalling ( Daluiski et al, 2001 ; Figure 2—figure supplement 1 , Supplementary file 4 ).…”

Segregation of brain and organizer precursors is differentially regulated by Nodal signaling at blastula stage

“…The following primers were used for RT-qPCR: chrd.1 F: ACTGCCAGGACTGGATGGT, chrd.1 R: GGCAGGATTTAGAGTTGCTTC ( Leibovich et al, 2018 ); gsc F: TTCACCGATGAACAACTGGA, gsc R: TTCCACTTTTGGGCATTTTC ( Leibovich et al, 2018 ); histone H4 F: GGCAAAGGAGGAAAAGGACTG, histone H4 R: GGTGATGCCCTGGATGTTGT ( Cao et al, 2007 ); mix1 F: CAAAAGCCACCAAGCCCATT, mix1 R: TGCTGAAGGAAACATTGCCC ( Sun et al, 2015 ); sox2 F: GAGGATGGACACTTATGCCCAC, sox2 R: GGACATGCTGTAGGTAGGCGA E.M. (De Robertis ).…”

BMP Signaling: Lighting up the Way for Embryonic Dorsoventral Patterning

“…Subsequent studies have found that the dorsal organizer secretes another BMP protein—Admp—which is inhibited by Chordin. This forms a part of the feedback regulation of the Chordin/BMP system ( Reversade and De Robertis, 2005 ; Leibovich et al, 2018 ). Admp is specifically expressed in the Xenopus organizer, sharing similar sequence and ventral-promoting effects with other ventrally-expressed BMPs like BMP2/4/7 ( Kimelman and Pyati, 2005 ; Reversade and De Robertis, 2005 ; Leibovich et al, 2018 ).…”

“…This forms a part of the feedback regulation of the Chordin/BMP system ( Reversade and De Robertis, 2005 ; Leibovich et al, 2018 ). Admp is specifically expressed in the Xenopus organizer, sharing similar sequence and ventral-promoting effects with other ventrally-expressed BMPs like BMP2/4/7 ( Kimelman and Pyati, 2005 ; Reversade and De Robertis, 2005 ; Leibovich et al, 2018 ). As a result, only the depletion of all four BMPs results in a complete loss of ventral fate ( Reversade and De Robertis, 2005 ).…”

“…In Xenopus , Admp expression is repressed by ventral BMP signals and depletion of the ventral BMP signals increase Admp expression. This allows for the regeneration of a new BMP signal gradient ( Leibovich et al, 2018 ). In zebrafish, the organizer-expressed bmp2b and admp are also responsible for ensuring the stabilization of DV patterning ( Reversade and De Robertis, 2005 ; Xue et al, 2014 ).…”