Allele-Specific Gene Editing Rescues Pathology in a Human Model of Charcot-Marie-Tooth Disease Type 2E

Abstract

Many neuromuscular disorders are caused by dominant missense mutations that lead to dominant-negative or gain-of-function pathology. This category of disease is challenging to address via drug treatment or gene augmentation therapy because these strategies may not eliminate the effects of the mutant protein or RNA. Thus, effective treatments are severely lacking for these dominant diseases, which often cause severe disability or death. The targeted inactivation of dominant disease alleles by gene editing is a promising approach with the potential to completely remove the cause of pathology with a single treatment. Here, we demonstrate that allele-specific CRISPR gene editing in a human model of axonal Charcot-Marie-Tooth (CMT) disease rescues pathology caused by a dominant missense mutation in the neurofilament light chain gene (NEFL, CMT type 2E). We utilized a rapid and efficient method for generating spinal motor neurons from human induced pluripotent stem cells (iPSCs) derived from a patient with CMT2E. Diseased motor neurons recapitulated known pathologic phenotypes at early time points of differentiation, including aberrant accumulation of neurofilament light chain protein in neuronal cell bodies. We selectively inactivated the disease NEFL allele in patient iPSCs using Cas9 enzymes to introduce a frameshift at the pathogenic N98S mutation. Motor neurons carrying this allele-specific frameshift demonstrated an amelioration of the disease phenotype comparable to that seen in an isogenic control with precise correction of the mutation. Our results validate allele-specific gene editing as a therapeutic approach for CMT2E and as a promising strategy to silence dominant mutations in any gene for which heterozygous loss-of-function is well tolerated. This highlights the potential for gene editing as a therapy for currently untreatable dominant neurologic diseases.

Neurofilament Light Regulates Axon Caliber, Synaptic Activity, and Organelle Trafficking in Cultured Human Motor Neurons

“…Neurofilament accumulations and reduced number of neurofilaments were also observed in cultured dorsal root ganglia neurons of the mice ( Zhao et al, 2017 ). In addition, stem cell–derived neuron models of dominant NEFL missense mutations show neurofilament aggregates and reduced mitochondrial transport ( Saporta et al, 2015 ; Feliciano et al, 2021 ; Van Lent et al, 2021 ). Therefore, the NEFL missense mutations seem to cause neuropathy through accumulation of neurofilaments in the soma, which reduces their amount and functionality in axons.…”

Two therapeutic CRISPR/Cas9 gene editing approaches revert FTD/ALS cellular pathology caused by aC9orf72repeat expansion mutation in patient derived cells

“…We first knocked-in the inducible motor neuron transcription factor transgene cassette 51, 82 in the CLYBL safe-harbor locus of a C9-patient line using spCas9 and ATGTTGGAAGGATGAGGAAA gRNA. This transgene includes human NGN2, ISL1, LHX3 (hNIL) under the TET operator and is inducible by doxycycline, mCherry (for positive selection) and neomycin antibiotic resistance (for negative fluorescence).…”

“…Introduction of doxycycline for 3 days induced the expression of 3 human transcription factors: NGN2, ISL1, LHX3. We followed the previously published protocol 51, 82 with notable exceptions, including higher concentrations of the growth factors BDNF, GDNF and NT-3 (each at 20 ng/ml). Our detailed protocol is published 86 .…”

“…We designed our approaches to avoid these pitfalls, taking advantage of the CRISPR/Cas9 system as a highly specific genome editing tool and of newly engineered Cas9 variants capable of distinguishing alleles differing by even a single base pair [48][49][50][51][52][53][54][55] . Here we report our success at reverting hallmarks of disease, mRNA abnormalities and loss of nuclear TDP-43, in human motor neurons derived from diseased iPSCs with three strategies: (1) bi-allelic excision of the repeat region, (2) allele-specific excision of the mutant allele leaving the normal allele intact and (3) excision of a regulatory region (exon 1A) that controls expression of the mutant allele's sensestrand.…”

Diseased, differentiated and difficult: Strategies for improved engineering of in vitro neurological systems

“…Combinations of transcription factors (TFs) have been used to produce dopaminergic neurons, sensory neurons, motor neurons, and cortical GABAergic neurons, among others ( Goto et al, 2017 ; Yang et al, 2017 ; Azimi et al, 2018 ; Nickolls et al, 2020 ). Such targeted strategies allow for screening of disease phenotypes (e.g., disease-in-a-dish), high-throughput drug screens, and could potentially serve as a cell source for cell replacement therapies ( Wang et al, 2017 ; Feliciano et al, 2021 ). However, induced approaches exist for very few of the vast diversity of neuron types within the body.…”