Allelic discrimination by nick-translation PCR with fluorgenic probes

Abstract

Nick-translation PCR was performed with fluorogenic probes. Two probes were used: one complementary to a sequence containing the F508 codon of the normal human cystic fibrosis (CF) gene (wt DNA) and one complementary to a sequence containing the delta F508 three base pair deletion (mut DNA). Each probe contained a unique and spectrally resolvable fluorescent indicator dye at the 5' end and a common quencher dye attached to the seventh nucleotide from the 5' end. The F508/delta F508 site was located between the indicator and quencher. The probes were added at the start of a PCR containing mut DNA, wt DNA or heterozygous DNA and were degraded during thermal cycling. Although both probes were degraded, each probe generated fluorescence from its indicator dye only when the sequence between the indicator and quencher dyes was perfectly complementary to target. The identify of the target DNA could be determined from the post-PCR fluorescence emission spectrum.

Segregation of HLA/TNF region is linked to leprosy clinical spectrum in families displaying mixed leprosy subtypes

“…The VDR-1056 C/T SNP region was amplified using primers described by Roy et al 14 The resulting amplification product was digested with 1.5 units of TaqI restriction enzyme for 6 h at 651C, and the allelic composition at the VDR-1056 locus was obtained by fragment sizing on a 2.5% agarose gel. The VDR-117 T/C SNP was genotyped using primers and conditions as described by Scott et al 33 Finally, the TNF-(À308) G/A SNP was genotyped by means of a 5 0 nuclease assay 34,35 employing the forward primer, 5 0 CCAAAAGAAATGGAGGCAAT3 0 , the reverse primer, 5 0 GCCACTGACTGATTTGTGTGT3 0 , and 5'FAM-CCGT CCCCATGCCCCTCAAA-TAMRA3 0 and 5'TET-CCG TCCTCATGCCCCTCAAA-TAMRA3 0 as allele-specific oligonucleotides. The calling of the genotypes was based on the FAM/TET ratio as read in a Perkin-Elmer LS-5B fluorescence spectrometer with 5 nm slit widths.…”

Cleavage-based signal amplification of RNA

“…Likewise, miRNA is too short to be amplified by PCR directly, which makes the PCR design very sophisticated 10,11 . Thermal cycling of the PCR technique imposes instrumental constraints, limiting the technique to a laboratory setting, and dual-labelled fluorescent probes, such as Taqman probes 12 , are usually needed to determine the specificity of amplification. Therefore, isothermal amplification of RNA, such as nucleic acid sequence-based amplification [13][14][15] , rolling-cycle amplification 16,17 and loopmediated isothermal amplification 18,19 have emerged as alternative amplification techniques.…”

“…Two kinds of catalytic DNA sequences, RNA-cleaving DNAzyme (10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20)(21)(22)(23) 26,27 and G-quadruplex horseradish peroxidase-mimicking DNAzyme (PW17) [28][29][30] were applied in our research. The 10-23 RNAcleaving DNAzyme has been reported to cleave any purinepyrimidine (RY) junction under simulated physiological conditions 26 ; hence, it was applied in our strategy for the cleaving of target RNA molecule to initiate the following exponential amplification.…”

NRAMP1 is not associated with asthma, atopy, and serum immunoglobulin E levels in the French Canadian population

“…63 Variants D543N and 1729 þ 55del4 were genotyped by TaqMan assays. 64 Each variant was analyzed using two sets of oligonucleotides (external primers and internal probes) designed using the Primer3 software. The internal probes were labelled with fluorescent dyes: TAMRA (6-carboxytetramethyl-rhodamine) at 3 0 ends, FAM (6-carboxy-fluorescein) and TET (6-carboxy-4,7,2 0 ,7 0 -tetrachlorofluorescein) (one per oligonucleotide) at 5 0 ends.…”