An instance of clinical radiation morbidity and cellular radiosensitivity, not associated with ataxia-telangiectasia

Plowman, P N; Bridges, B.A.; Arlett, C.F.; Hinney, Arah R. M C W; Kingston, J. E.

doi:10.1259/0007-1285-63-752-624

Cited by 103 publications

(61 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…GATCGGGCCCCCCCTCGAGGTCGAC GGATCCACTAGTTCTAGAGCGGCCG Control (7 experiments) age of 14 years and was recognized as Lig4 deficiency because of an over-response to radiotherapy [25][26][27]. A second series of five patients exhibited developmental delay, microcephaly, and various degrees of immunodeficiency [20,21].…”

Section: Germ-line Sequences A)mentioning

confidence: 99%

Severe combined immunodeficiency and microcephaly in siblings with hypomorphic mutations in DNA ligase IV

et al. 2005

View full text Add to dashboard Cite

DNA double-strand breaks (dsb) during V(D)J recombination of T and B lymphocyte receptor genes are resolved by the non-homologous DNA end joining pathway (NHEJ) including at least six factors: Ku70, Ku80, DNA-PK cs , Artemis, Xrcc4, and DNA ligase IV (Lig4). Artemis and Lig4 are the only known V(D)J/NHEJ factors found deficient in human genetic disorders. Null mutations of the Artemis gene result in a complete absence of T and B lymphocytes and increased cellular sensitivity to ionizing radiations, causing radiosensitive-SCID. Mutations of Lig4 are exclusively hypomorphic and have only been described in six patients, four exhibiting mild immunodeficiency associated with microcephaly and developmental delay, while two patient had leukemia. Here we report a SCID associated with microcephaly caused by compound heterozygous hypomorphic mutations in Lig4. Residual activity of Lig4 in these patients is underscored by a normal pattern of TCR-a and -b junctions in the T cells of the patients and a moderate impairment of V(D)J recombination as tested in vitro. These observations contrast with the severity of the clinical immunodeficiency, suggesting that Lig4 may have additional critical roles in lymphocyte survival beyond V(D)J recombination.

show abstract

Section: Germ-line Sequences A)mentioning

confidence: 99%

Severe combined immunodeficiency and microcephaly in siblings with hypomorphic mutations in DNA ligase IV

et al. 2005

View full text Add to dashboard Cite

show abstract

“…The extreme radiosensitivity of cell lines established from this individual is consistent with the predicted role of DNA ligase IV in the repair of DNA double-strand breaks by NHEJ. Surprisingly, the DNA ligase IV-deficient individual did not appear to be immunodeficient, and the DNA ligase IV-deficient cell line had no apparent defect in V(D)J recombination (16,23). In contrast, gene targeting studies have provided compelling evidence linking DNA ligase IV with V(D)J recombination.…”

mentioning

confidence: 99%

Interactions of the DNA Ligase IV-XRCC4 Complex with DNA Ends and the DNA-dependent Protein Kinase

Chen

Trujillo

Sung

et al. 2000

Journal of Biological Chemistry

204

145

View full text Add to dashboard Cite

Three genes encoding DNA ligases, LIG1, LIG3, and LIG4, have been identified in the mammalian genome (1). The products of these genes appear to be responsible for the DNAjoining events that complete DNA replication, genetic recombination, and DNA repair in mammalian cells. In the lower eukaryote Saccharomyces cerevisiae, the DNA ligases encoded by the CDC9 and DNL4 genes are functional homologs of the LIG1 and LIG4 genes. However, this organism apparently lacks a LIG3 gene homolog (2-5).Mammalian DNA ligases consist of a conserved catalytic domain flanked by unrelated sequences (1). It has been suggested that protein-protein interactions mediated by the unique regions flanking the catalytic domain determine the cellular functions of these enzymes. In support of this hypothesis, recent studies have identified specific protein partners for each of the LIG gene products. The non-catalytic N-terminal domain of DNA ligase I interacts with both proliferating cell nuclear antigen and DNA polymerase ␤, implicating this species of DNA ligase in DNA replication and excision repair pathways (6, 7). In contrast, the non-catalytic C-terminal extensions of DNA ligases III␣ and IV contain BRCT motifs (8), a putative protein-protein interaction domain first identified in the protein encoded by the breast cancer susceptibility gene BRCA1 (9, 10). The single BRCT motif of DNA ligase III␣ mediates complex formation with the DNA repair protein XRCC1, linking this species of DNA ligase with base excision repair and the repair of DNA single-strand breaks (11,12). Similarly, the region of DNA ligase IV containing tandem BRCT motifs is involved in complex formation with the DNA repair protein XRCC4,implicating DNA ligase IV in non-homologous end joining (NHEJ) 1 and V(D)J recombination (13, 14). Human individuals with mutations in either the LIG1 (15) or LIG4 gene (16) have been identified. The initial symptoms of the individual with DNA ligase I deficiency were recurrent infections caused by severe combined immunodeficiency (17). Cell lines established from this patient exhibited defects in Okazaki fragment joining and sensitivity to a wide range of DNA-damaging agents, a phenotype consistent with the predicted role of DNA ligase I in DNA replication and excision repair (18,19). When the DNA ligase I-deficient cells were activated for V(D)J recombination by ectopic expression of the RAG proteins, there was no apparent defect in this type of recombination (20,21). However, studies with cell-free extracts suggest that DNA ligase I contributes to the completion of V(D)J recombination (22).The individual with a mutated LIG4 gene presented with leukemia. Unfortunately, attempts to treat this disease with chemotherapy and then ionizing radiation caused a severe reaction (16,23). The extreme radiosensitivity of cell lines established from this individual is consistent with the predicted role of DNA ligase IV in the repair of DNA double-strand breaks by NHEJ. Surprisingly, the DNA ligase IV-deficient individual did not appear to be immunodefi...

show abstract

“…Lymphoid tumours have been observed in a small number of patients, usually those with milder immunodeficiency, including the mild patient described above who displayed no overt immunodeficiency but developed leukaemia (Table 1) [44,49,50]. In all cases examined, patient fibroblasts show radiosensitivity and diminished DSB repair capacity, which can be observed from early times post exposure (Fig.…”

Section: Lig4 Syndromementioning

confidence: 86%

“…no obvious immunodeficiency) but developed acute lymphoblastic leukaemia at age 14. The patient subsequently dramatically over-responded to cranial radiation treatment and died from radiation morbidity [43,44]. This patient proved to have a homozygous R278H missense mutation which reduced DNA ligase IV activity to ∼10% of the control level.…”

Section: Lig4 Syndromementioning

confidence: 97%

“…Thus, knowledge of a patient's genetic defect can be beneficial in deciding if BMT is the preferred treatment and/or if radiotherapy can be exploited during treatment. Indeed, the first LIG4 Syndrome patient identified showed a marked over-response to radiotherapy [44]. Although BMT can relieve the immunodeficiency of RS-SCID, all the non-immune somatic cells will retain DSB repair defect and potentially enhanced genomic instability.…”

Section: How Does Our Knowledge Enhance Patient Carementioning

confidence: 99%

See 1 more Smart Citation

Reprint of “The clinical impact of deficiency in DNA non-homologous end-joining”

2014

View full text Add to dashboard Cite

Double strand break repair V(D)J recombination (Severe) combined immunodeficiency -(S)CID Human syndromes a b s t r a c t DNA non-homologous end-joining (NHEJ) is the major DNA double strand break (DSB) repair pathway in mammalian cells. Defects in NHEJ proteins confer marked radiosensitivity in cell lines and mice models, since radiation potently induces DSBs. The process of V(D)J recombination functions during the development of the immune response, and involves the introduction and rejoining of programmed DSBs to generate an array of diverse T and B cells. NHEJ rejoins these programmed DSBs. Consequently, NHEJ deficiency confers (severe) combined immunodeficiency -(S)CID -due to a failure to carry out V(D)J recombination efficiently. NHEJ also functions in class switch recombination, another step enhancing T and B cell diversity. Prompted by these findings, a search for radiosensitivity amongst (S)CID patients revealed a radiosensitive sub-class, defined as RS-SCID. Mutations in NHEJ genes, defining human syndromes deficient in DNA ligase IV (LIG4 Syndrome), XLF-Cernunnos, Artemis or DNA-PKcs, have been identified in such patients. Mutations in XRCC4 or Ku70,80 in patients have not been identified. RS-SCID patients frequently display additional characteristics including microcephaly, dysmorphic facial features and growth delay. Here, we overview the clinical spectrum of RS-SCID patients and discuss our current understanding of the underlying biology.

show abstract

An instance of clinical radiation morbidity and cellular radiosensitivity, not associated with ataxia-telangiectasia

Cited by 103 publications

References 22 publications

Severe combined immunodeficiency and microcephaly in siblings with hypomorphic mutations in DNA ligase IV

Severe combined immunodeficiency and microcephaly in siblings with hypomorphic mutations in DNA ligase IV

Interactions of the DNA Ligase IV-XRCC4 Complex with DNA Ends and the DNA-dependent Protein Kinase

Reprint of “The clinical impact of deficiency in DNA non-homologous end-joining”

Contact Info

Product

Resources

About