An L-type calcium-channel gene mutated in incomplete X-linked congenital stationary night blindness

Abstract

The locus for the incomplete form of X-linked congenital stationary night blindness (CSNB2) maps to a 1.1-Mb region in Xp11.23 between markers DXS722 and DXS255. We identified a retina-specific calcium channel alpha1-subunit gene (CACNA1F) in this region, consisting of 48 exons encoding 1966 amino acids and showing high homology to L-type calcium channel alpha1-subunits. Mutation analysis in 13 families with CSNB2 revealed nine different mutations in 10 families, including three nonsense and one frameshift mutation. These data indicate that aberrations in a voltage-gated calcium channel, presumably causing a decrease in neurotransmitter release from photoreceptor presynaptic terminals, are a frequent cause of CSNB2.

Thenob2mouse, a null mutation inCacna1f: Anatomical and functional abnormalities in the outer retina and their consequences on ganglion cell visual responses

“…While nob RGCs could be characterized as responding to the onset of either a bright or dark stimulus, their receptive fields show no evidence of center-surround organization (Gregg et al, 2005). nob2 mice provide a model for human disease CSNB2 is a human retinal disorder that also is caused by mutations within the Cacna1f gene (Bech-Hansen et al 1998;Strom et al 1998;Zeitz et al, 2005). While most CSNB disorders are the result of null mutations, some may actually increase calcium entry but reduce overall function by shifting the operating range Hoda et al, 2005).…”

“…The incomplete form, CSNB2, is caused by mutations in the Cacna1f gene, encoding the α 1F subunit of VDCCs (Bech-Hansen et al, 1998;Strom et al, 1998;Boycott et al, 2001;Wutz et al, 2002). In the outer retina, expression of the α 1F subunit has been localized to the OPL where it is concentrated on the presynaptic side in the terminals of the photoreceptors at their "active zones," which are specialized to mediate continuous calcium-dependent neurotransmitter release (Morgans et al, 2001).…”

Mutations in theCACNA1F andNYX genes in British CSNBX families

“…Haplotype and linkage analyses were performed to define disease gene boundaries in several large families, as described in Hardcastle et al 1997. Affected male patient DNA was PCR amplified for the 48 exons of CACNA1F using primers and conditions described in Strom et al, 1998. Exon 2 of NYX was analysed as described by Pusch et al, 2000 and exon 3 primers were redesigned (3aF: gacctttggctgacggttgc and 3aR: gtgcaggtagcgcaggtcg in 15 mM MgCl 2 ; 3bF: acaacctgtccttcatcacgc and 3bR: caggttgagcggcgcagg in 10 mM MgCl 2 ; 3cF: gactgtggcgtcctggagc and 3cR: ggtcacctggctgaggtcc in 10 mM MgCl 2 ; 3dF: atggagggctccggacgtg and 3dR: ttaccacaaacacactcaagcc in 15 mM MgCl 2 ).…”

“…Two causative genes (CACNA1F and NYX) for CSNBX have now been identified through positional cloning strategies (Bech-Hansen et al, 1998;Strom et al, 1998;Bech-Hansen et al, 2000;Pusch et al, 2000). Many mutations in the novel voltage-gated L-type calcium channel α 1F subunit gene (CACNA1F; MIM# 300110) have been described (Bech-Hansen et al, 1998;Strom et al, 1998;Nakamura et al, 2001).…”

“…Many mutations in the novel voltage-gated L-type calcium channel α 1F subunit gene (CACNA1F; MIM# 300110) have been described (Bech-Hansen et al, 1998;Strom et al, 1998;Nakamura et al, 2001). This gene maps to Xp11.23, is predominantly expressed in the retina, and is reported to cause the "incomplete" form of CSNBX (CSNB2).…”