Analysis by polymerase chain reaction of the physical state of human papillomavirus type 16 DNA in cervical preneoplastic and neoplastic lesions

Abstract

Integration of human papillomavirus (HPV) DNA into the host cell genome is believed to be essential for malignant progression. However unambiguous detection of the physical state of HPV is a difficult and timeconsuming procedure. To resolve this issue a simple, rapid and highly sensitive technique of polymerase chain reaction (PCR) has been utilized for detecting the physical state of HPV-16 DNA. Investigations were carried out in 122 cervical specimens comprising the whole spectrum of cervical lesions starting from cervical dysplasia to invasive carcinoma including HPV-16-positive normal controls. A pair of oligonucleotide primers specific to the E2 open reading frame, which is often deleted or disrupted following HPV integration, was used for the study. Distinction between episomal and integrated forms of viral DNA was accomplished by detecting amplification of the E2-specific fragment (1139 bp) in the PCR product. The PCR results were compared with those obtained by the conventional methods of Southern blotting, twodimensional gel electrophoresis and chromosomal in situ hybridization; a high degree of agreement was observed between the methods. The findings indicate that although integrated forms of HPV-16 DNA were detected in more than 70% of cervical cancer specimens, integration was less frequent (23%) in severe dysplasia and carcinoma in situ. Only 2.5 % of cases showed both episomal and integrated forms ofHPV-16 DNA. The difference between episomal and integrated forms was statistically significant (P<0.01). The absence of integration in about 30% of cancer cases suggests that integration of HPV may not be necessary for malignant progression and alternative mechanism(s) of malignant transformation may occur without HPV integration. The PCR test thus provides an effective complement to Southern blotting and twodimensional gel electrophoresis for accurate detection of the integration of HPV DNA.

Functional significance of sequence variation in the E2 gene and the long control region of human papillomavirus type 16.

“…Papillomavirus E2 proteins were reported to down-regulate the major early promoters of genital HPVs involved in the transcription of the E6 and E7 oncogenes. On the other hand, the E1 and\or E2 gene regions of oncogenic HPV types were shown to be inactivated through integration of the viral genome into host DNA, which is a frequent event in carcinogenesis (Das et al, 1992). It was suggested that this mechanism has a major role in the up-regulation of the early HPV promoters in cervical cancer.…”

“…The E2 ORF was amplified from HPV-16-positive cervical cancer specimens by PCR using the primers E2\1 (5h GCGCGAATCCAGGACGAGGACAAGGAAAA 3h ; nt 2735-2753) and E2\2 (5h GCGCGAATCCGGATGCAGTATC-AAGATTTG 3h ; nt 3854-3873) (artificial EcoRI sites used for cloning in both primers are underlined). In this PCR, a 1139 bp long amplimer was produced, which included the whole E2 gene (Das et al, 1992). Amplification was performed with Pwo polymerase (an enzyme with proof-reading activity), according to the manufacturer's recommendations (Boehringer Mannheim).…”

Telomerase activity as an adjunct to high-risk human papillomavirus types 16 and 18 and cytology screening in cervical cancer

“…A gene fragment of the b-globin was used as an internal control to check the integrity of the specimens. Further HPV typing was carried out using type-specific primers for HPV types 16, 18, 6 and 11 (Das et al, 1992a). Polymerase chain reaction products were separated electrophoretically on an ethidium bromide stained 3% Nusieve agarose gel.…”

Sequence variation and physical state of human papillomavirus type 16 cervical cancer isolates from Australia and New Caledonia

“…Polymerase chain reaction (PCR) for the URR, E6, E2 and E4 genes were carried out as published by May et al, 11 Wheeler et al 12 and Das et al, 13 respectively. The controls used and the precautions taken to minimize the possibility of cross-contamination of specimens at all stages of processing were as previously published.…”

“…13 The specificity of the E2 PCR products was confirmed either by sequencing or by cleavage with Hinc II to produce bands of 662 bp and 476 bp.…”