Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression

Abstract

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Exploration of the Native Sucrose Operon Enables the Development of an Inducible T7 Expression System in Paenibacillus polymyxa

“…In palindromic structures, the rigor at the binding site determines the binding efficiency of the repressor protein, and asymmetric bases may increase the binding efficiency of repressor proteins. 13 However, the binding efficiency of ScrR increased with an increase in symmetry in the binding sites. Considering these results, we speculated that base changes occurring at the periphery of the palindromic structure cause lower efficiency in repressor binding; conversely, mutations located near the central G/C base pair have a significant effect on ScrR binding.…”

“…Furthermore, variations in individual bases can cause different binding efficiencies, leading to a binding preference of the ScrR protein for specific sequences. In palindromic structures, the rigor at the binding site determines the binding efficiency of the repressor protein, and asymmetric bases may increase the binding efficiency of repressor proteins . However, the binding efficiency of ScrR increased with an increase in symmetry in the binding sites.…”

“…The electrotransformation competent cell preparation process for P. polymyxa DSM365 was based on the method used for P. polymyxa ATCC842. 13 To prepare electrocompetent P. polymyxa DSM365, the strain was streaked onto LB agar plates incubated at 30 °C for 24 h. Selected colonies were transferred to 15 mL of LB medium in a flask and cultured overnight at 30 °C and 200 rpm. Following this, 2.5 mL of the overnight culture was inoculated into 50 mL electrotransformation medium (LB medium containing 0.5 mol/L sorbitol), and incubated at 37 °C, 250 rpm for 8 h until reaching an optical density at 600 nm (OD 600 ) of approximately 0.8−0.9.…”

“…polymyxa, previously investigated and utilized inducible expression elements are limited to the temperature-sensitive expression element PsgsE and the xylose-inducible element P xyl. , Carbon source-specific gene regulation is common in various bacteria, which enables fine energy management. The sucrose operon is recognized for its economical inducer and favorable induction efficiency.…”

Engineering the Maize Root Microbiome: A Rapid MoClo Toolkit and Identification of Potential Bacterial Chassis for Studying Plant–Microbe Interactions

“…There have also been efforts to create genetic toolkits/collections that are generalizable to larger groups of organisms like Gram-negative bacteria, proteobacteria, and both prokaryotes and eukaryotes. − In the context of plant-associated microbes, the well-studied Bacillus subtilis − and Pseudomonas species − have genetic toolkits that allow for tunable and inducible expression, genome engineering and protein secretion. While genetic tools are being adapted and developed in more nonmodel, plant-associated microbes, , single microbiome toolkits and high transformation efficiencies (a prerequisite for high-throughput genetics) remain an elusive bottleneck.…”