Anatomical features of the urethra and urinary bladder catheterization in female mice and rats. An essential translational tool

Abstract

PURPOSE:To present fundamental anatomical aspects and technical skills necessary to urethra and urinary bladder catheterization in female mice and rats. METHODS: Urethral and bladder catheterization has been widely utilized for carcinogenesis and cancer research and still remains very useful in several applications: from toxicological purposes as well as inflammatory and infectious conditions to functional aspects as bladder dynamics and vesicoureteral reflux, among many others. RESULTS: Animal models are in the center of translational research and those involving rodents are the most important nowadays due to several advantages including human reproducibility, easy handling and low cost. CONCLUSIONS: Although technical and anatomical pearls for rodent urethral and bladder access are presented as tackles to the advancement of lower urinary tract preclinical investigation in a broaden sight, restriction to female animals hampers the male microenvironment, demanding future advances. Key words: Urinary Tract. Rodent Diseases. Anatomy. Rats. RESUMO OBJETIVO:Apresentar aspectos anatômicos fundamentais e habilidades técnicas necessárias para cateterismo da uretra e bexiga em ratos e camundongos fêmeas. MÉTODOS: Cateterismo vesical tem sido amplamente utilizado na pesquisa do câncer e carcinogênese, além de várias outras aplicações, desde fins toxicológicos, condições inflamatórias e infecciosas até aspectos funcionais como a dinâmica vesical e refluxo vesico-ureteral, entre muitos outros. RESULTADOS: Os modelos animais estão no centro da investigação de translação e os roedores são os mais importantes devido a várias vantagens, incluindo reprodutibilidade humana, o fácil manuseio e baixo custo. CONCLUSÕES: Apesar de permitir o desenvolvimento da investigação pré-clínica do trato urinário inferior, o modelo se restringe aos animais do sexo feminino, de modo que avanços futuros são necessários. Descritores: Sistema Urinário. Doenças dos Roedores. Anatomia. Ratos. Anatomical features of the urethra and urinary bladder catheterization in female mice and rats. An essential translational tool

Alteraciones en el tracto urinario durante la infección con Proteus mirabilis que expresa la toxina codificada en plásmido (Pet)

“…Five mice were employed in each group viz., P. mirabilis (Pet+), EAEC 042 (Pet+), P. mirabilis (Pet-) and a control group remained uninfected (inoculated only with PBS). Mice were anesthetized with ketamine [60mg/Kg] and xilazine [10mg/Kg], and transurethral inoculated with 50 μL of the corresponding bacterial suspension containing approximately 5X10 7 CFU (Reis et al, 2011;Hung, Dodson & Hultgren, 2009).…”

Functional insights from KpfR, a new transcriptional regulator of fimbrial expression that is crucial forKlebsiella pneumoniaepathogenicity

“…For mouse urinary tract infection analyzes were used 6-8 weeks-old female BALB/c mice (CEMIB, UNICAMP, Brazil). Infections were carried out by transurethral inoculation as previously described (46,47). UKP8 and kpfR::kan R strains were grown on LB agar plates at 37°C for 18 h and resuspended at a concentration of 5 x 495-496 CATCATATTGCTAAGGTCGGTGGCCTGA GC-intron-AATTTTCTTATTATT 9.52 0,034…”

Editorial Comment to Orthotopic mouse model of renal pelvic cancer using a human bladder cancer cell line

“…Most UTUCs are found to be invasive at diagnosis, whereas most bladder urothelial cancers are non‐muscle invasive. Though it corresponds to approximately 10% of all human urothelial cancers, extrapolating data from the other 90% (mainly bladder cancer) might deter the advancement of UTUC knowledge and management …”

“…Although they are strong tools, there is no perfect animal model. The restriction to female animals to allow intravesical drug delivery, limiting off‐target effects in an extraordinary example of direct therapeutics administration against solid tumor, it impedes the male microenvironment because of the challenges related to the common duct for reproduction and urinary functions in males …”