Angiotensin-converting enzyme activity and inhibition in dogs with cardiac disease and an angiotensin-converting enzyme polymorphism

Abstract

Objective:The objective of this study was to evaluate angiotensin-converting enzyme (ACE) activity in dogs and with and without an ACE polymorphism in the canine ACE gene, before and after treatment with an ACE inhibitor.Methods:Thirty-one dogs (20 wild-type, 11 ACE polymorphism) with heart disease were evaluated with ACE activity measurement and systolic blood pressure before and after administration of an ACE inhibitor (enalapril).Results:Median pre-treatment ACE activity was significantly lower for ACE polymorphism dogs than for dogs with the wild-type sequence (P=0.007). After two weeks of an ACE inhibitor, ACE activity was significantly reduced for both genotypes (wild-type, P<0.0001; ACE polymorphism P=0.03); mean post-therapy ACE activity was no different between the groups.Conclusion:An ACE polymorphism is associated with lower levels of ACE activity. Dogs with the polymorphism still experience suppression of ACE activity in response to an ACE inhibitor. It is possible that the genetic status and ACE activity of dogs may impact the response of dogs with this variant to an ACE inhibitor.

Renin‐angiotensin aldosterone profile before and after angiotensin‐converting enzyme‐inhibitor administration in dogs with angiotensin‐converting enzyme gene polymorphism

“…Although unexpected, this might be explained by the different methodologies used to quantify ACE activity between studies. Radioenzymatic assay was utilized in previous reports to directly measure the activity of the ACE enzyme . The activity of ACE in the current study was determined indirectly using the turnover of angiotensin I to angiotensin II, measured by equilibrium analysis.…”

“…This study failed to demonstrate different degrees of ACE activity based on genotype before ACE-inhibitor treatment, in contrast to results of previous studies. 13,14 Although unexpected, this might be explained by the different methodologies used to quantify ACE activity between studies. Radioenzymatic assay was utilized in previous reports to directly measure the activity of the ACE enzyme.…”

“…Dogs with other systemic diseases as evident from routine chemistry panel or history were excluded. This study utilized samples stored from dogs meeting inclusion criteria that were previously genotyped for the ACE gene polymorphism at 9:11507816:G>A, 19 of which were previously reported . Biochemistry results, blood pressure, and ACE activity determined by radioenzymatic activity have been previously reported .…”

“…The previously validated primers (forward, 5′ TCAGCTCCATGCAATCCATA 3′; reverse 5′ CCCCTTGCCCTATCTGTAAA 3′) were used to carry out standard PCR amplification . Sequencing was visually inspected using commercially available software to identify the presence or absence of the known canine ACE gene polymorphism at 9:11507816:G>A, and if present, the genotypes (heterozygous or homozygous).…”

“…Angiotensin‐converting enzyme‐inhibitors prevent the conversion of angiotensin I to angiotensin II, and thereby mitigate the maladaptive effects of these neurohormones through reduced formation of angiotensin II and angiotensin‐II‐driven aldosterone production . Polymorphisms of the ACE gene are recognized in human beings and dogs, which could influence the therapeutic strategies and outcome of diseases in which the RAAS plays a pathogenic role . Directly measured ACE activity is lower in dogs that are homozygous for a single base pair ACE gene polymorphism compared to dogs without the polymorphism; however, ACE activity after administration of ACE‐inhibitors is similarly suppressed regardless of genotype .…”