Anti-neoplastic properties of hydralazine in prostate cancer

Abstract

Prostate cancer (PCa) is a major cause of cancer-related morbidity and mortality worldwide. Although early disease is often efficiently managed therapeutically, available options for advanced disease are mostly ineffective. Aberrant DNA methylation associated with gene-silencing of cancer-related genes is a common feature of PCa. Therefore, DNA methylation inhibitors might constitute an attractive alternative therapy. Herein, we evaluated the anti-cancer properties of hydralazine, a non-nucleoside DNA methyltransferases (DNMT) inhibitor, in PCa cell lines. In vitro assays showed that hydralazine exposure led to a significant dose and time dependent growth inhibition, increased apoptotic rate and decreased invasiveness. Furthermore, it also induced cell cycle arrest and DNA damage. These phenotypic effects were particularly prominent in DU145 cells. Following hydralazine exposure, decreased levels of DNMT1, DNMT3a and DNMT3b mRNA and DNMT1 protein were depicted. Moreover, a significant decrease in GSTP1, BCL2 and CCND2 promoter methylation levels, with concomitant transcript re-expression, was also observed. Interestingly, hydralazine restored androgen receptor expression, with upregulation of its target p21 in DU145 cell line. Protein array analysis suggested that blockage of EGF receptor signaling pathway is likely to be the main mechanism of hydralazine action in DU145 cells. Our data demonstrate that hydralazine attenuated the malignant phenotype of PCa cells, and might constitute a useful therapeutic tool.

Downregulation of MicroRNA-126 Contributes to the Failing Right Ventricle in Pulmonary Arterial Hypertension

“…The transcription factors E26 transformation-specific sequence-1 and -2, implicated in controlling miR-126 expression, were unchanged 24 in CRVH compared with DRV ( Figure IIIC in the online-only Data Supplement). Although the beneficial effects of hydralazine as a vasodilator are attributed to K + channel opening in ECs, 41 other potential effects include DNMT inhibition 30 and thus DNA methylation, which is known to regulate miR-126 expression. 42 Even if the effects of hydralazine on DNA Figure IIID-IIIG in the online-only Data Supplement).…”

“…Interestingly, methylation has been implicated in PAH pathogenesis 28 with the upregulation of DNA methyl transferase (DNMT). 29 Thus, DRV ECs were treated with hydralazine (a DNMT inhibitor 30 ). Hydralazine dose-dependently increased miR-126 in DRV ECs ( Figure IIID in the online-only Data Supplement).…”

The DNA methylation inhibitor induces telomere dysfunction and apoptosis of leukemia cells that is attenuated by telomerase over-expression

“…[8, 37, 38, 44, 45] DNMTIs were shown to cause replication lesions through which double-strand breaks of DNA, radial chromosomes and chromatid breaks are induced. [44] Jiemjit et al found that DNA damage also occurred in DNMT−/− cells exposed to DNMTIs, indicating that such effect is DNMT inhibition-independent.…”

VIRMA-Dependent N6-Methyladenosine Modifications Regulate the Expression of Long Non-Coding RNAs CCAT1 and CCAT2 in Prostate Cancer

“…Genetically modified PC-3 VIRMA CRISPR knockdown (PC-3 KD ) was generated by Synthego Corporation with the following guide RNA sequence: 5 CUAUGGGCUCUUACUCCUGG 3 . Cell culture were performed accordingly [55].…”