Antibacterial activity of Garlic, Tulsi, Bitter guard and Cinnamon extracts against wound pathogens

Mauti, Godfrey Omare; Mauti, Eliakim Mbaka; Ouno, Geoffrey Arasa; Mabeya, Benard Maronga

doi:10.31254/jsir.2015.4404

Cited by 6 publications

(4 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Garlic displayed the highest zone of inhibition at 25%, 75%, and 100% concentrations against P. aeruginosa, thus making it the most effective natural treatment against this organism. This is in line with the report of Mauti et al (2015). Garlic's antimicrobial properties are due to the presence of allicin, which disrupts the normal process of RNA production and lipid synthesis, affecting the synthesis of protein and cell wall of the microorganism, as well as other compounds present in garlic such as adjoene, enzymes (peroxidase and miracynase), different amino acids such as cysteine, glutamine, and methionine, and vitamins B and C. (Borlinghaus et al, 2014), which may also be responsible for its antimicrobial activity (Borlinghaus et al, 2014).…”

Section: Antibacterial Effect Of Honey Ginger and Garlic Against P Ae...supporting

confidence: 94%

Synergic antibacterial activity of honey-garlic versus honey-ginger on Pseudomonas aeruginosa and Klebsiella pneumoniae isolated from acute wound infection in Guyana, South America

Allen¹,

Daniel²,

Liverpool³

et al. 2023

GSC Biol. Pharm. Sci.

View full text Add to dashboard Cite

This study compared the antibacterial activity of honey-garlic and honey-ginger mixtures against two clinically important bacteria frequently implicated in acute wound infections; Pseudomonas aeruginosa and Klebsiella pneumoniae. Individual extracts of honey, ginger, garlic and erythromycin antibiotics (positive control), were also tested. Concentrations of 100%, 75%, 50%, and 25% of the natural extracts and mixtures were prepared by the use of sterilized distilled water as the solvent. The antibacterial activity of each natural extract and the antibiotic was tested against the aforementioned bacterial species at different concentrations using the disc diffusion method. Further, MIC and MBC tests were conducted on each natural mixture using the broth dilution method and spread plate method, respectively. Our results showed garlic exhibited the highest antibacterial activity against both bacteria at 100% concentration, whereas honey and ginger showed the lowest antibacterial activity against Klebsiella pneumoniae and Pseudomonas aeruginosa, respectively at 25% concentrations. Honey-garlic mixture was the most effective against Klebsiella pneumoniae, whereas honey-ginger mixture was the most effective against Pseudomonas aeruginosa. The antibiotic was more effective than the natural mixtures against Pseudomonas aeruginosa, but not so effective against Klebsiella pneumoniae. The MIC of both mixtures against Pseudomonas aeruginosa ranged from 25%-50%, while it ranged from 6%-50% for Klebsiella pneumoniae. Honey-garlic was the only mixture against Klebsiella pneumoniae that exhibited bactericidal effects at 50% (MBC).

show abstract

Section: Antibacterial Effect Of Honey Ginger and Garlic Against P Ae...supporting

confidence: 94%

Synergic antibacterial activity of honey-garlic versus honey-ginger on Pseudomonas aeruginosa and Klebsiella pneumoniae isolated from acute wound infection in Guyana, South America

Allen¹,

Daniel²,

Liverpool³

et al. 2023

GSC Biol. Pharm. Sci.

View full text Add to dashboard Cite

show abstract

“…The extracted DNA was resuspended in 50 μL of sterile water and stored at −20°C for PCR reactions. Using the universal primers UB_16SF (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and UB_16SR (5′‐GTACGCTACCTTGTTACGAC‐3′), bacterial endophyte strains were identified by 16S rDNA gene partial sequencing (Mauti et al., 2013). For each reaction, amplification was carried out in 40‐μl PCR tubes containing 1 μL MgCl2, 1 μL DNA, 4 μL Taq buffer, 0.5 μL Taq DNA Polymerase, 1 μL dNTPs, 2 μL of the primers, and 32 μL of nuclease‐free dH 2 O.…”

Section: Methodsmentioning

confidence: 99%

Molecular characterization of apple endophytic bacteria and biological effect on Alternaria rot on apple

Bektas,

Yazdıc,

Kusek

2024

Journal of Phytopathology

View full text Add to dashboard Cite

Apple rot disease, caused by Alternaria alternata, is causing significant losses in apple production, especially in post‐harvest periods. Alternaria alternata, was isolated from rotten apple fruit of cv Amasya. Identification of the strain isolated from rotten apple fruit was made by ITS sequence and morphological analysis. In the present study, 58 different endophytic bacteria strains were isolated from apple fruit for use in apple rot disease control. Among the isolated strains, 26 endophyte strains were determined to inhibit the radial growth of mycelia of A. alternata in binary culture in PDA media. Based on 16S rRNA sequencing analysis, these antagonistic endophytic bacteria strains were identified as Bacillus ssp. Bacillus methylotrophicus (ib17) showed the highest significant inhibitory effect on the mycelial growth of A. alternata at a rate of 79.5% in PDA medium. The results of in vivo experiments showed that Bacillus licheniformis (ib20) achieved 100% biocontrol when endophyte bacterial strains were inoculated 24 h before the inoculation of A. alternata. When the three bacteria species and A. alternata were inoculated simultaneously, Bacillus myloliquefaciens (ib1), Bacillus licheniformis (ib21) and the Endophytic bacterium (ib16) showed the highest biocontrol efficacy against A. alternata at 81.8%. Furthermore, when the bacterial strains were inoculated at 24 h after inoculation of A. alternata, B. licheniformis (ib21) showed the highest biocontrol efficacy of 83.3% against the fungal pathogen compared to the controls. The endophytic bacterial strains produced fungal cell wall hydrolysing enzymes such as chitinase, cellulase, amylase and protease. According to the results of this study, apple endophytic bacteria are potential candidates to control apple decay caused by A. alternata through cell wall hydrolysing enzymes and reduce disease severity. However, the efficacy of the biological control was dependent on the applied time of epiphytic bacterial strains. Further research is needed on the biochemical mechanisms underlying the activity of these bacteria against A. alternata.

show abstract

“…To provide an inexpensive, practical, stable, and successful delivery system for the treatment of wounds, many types of biopolymers are now being explored. 21 A study was conducted by Mauti et al (2015) to determine how well cinnamon, garlic, and turmeric worked against microbes.…”

Section: Evidence On Wound-healing Plantsmentioning

confidence: 99%

Medicinal Plants: An Insight into Wound Healing

Ullah

Kashif²,

Jamil

et al. 2022

THJ

View full text Add to dashboard Cite

Medicinal plants have been used for centuries to treat trauma, infection, sickness, and injury as these are affordable, easy to access and have fewer side effects than commercial pharmaceuticals. Recent research has shown that several medicinal plants can treat wounds using in vivo and in vitro pre-clinical models of wound recovery. Furthermore, the mechanisms by which these medicinal plants enhance wound therapy have also been revealed. Medicinal herbs have been shown in research to have the ability to have an antioxidant effect, to promote angiogenesis, to activate NF-B, to favor specific pro-inflammatory cytokines, to boost the appearance of iNOS and α-1 type-1 collagen, and to favor certain pro-inflammatory cytokines. All these effects can be brought about by medicinal herbs. Considering this, throughout this evaluation, an effort was made to provide a glimpse into freshly discovered medicinal plants that have wound recovery mechanisms and may be effective in the treatment and the invention of new wound-healing pharmaceuticals. Herbal medicines involve disinfection, debridement, and creating a healing environment. The purpose of the study was to review and gather the evidence related to the use of medicinal plants in wound healing. The use of herbal remedies is found to be both affordable and effective, mainly when used in conjunction with wound healing, bacterial activity and reducing oxidative stress in animals. During this evaluation, the cellular processes of recently discovered medicinal plants with a capacity for wound healing were brought to light. These mechanisms can potentially be helpful in therapeutic practice and the advancement of innovative medications for treating wounds. Several factors can delay the wound-healing process such as anemia, diabetes, nutritional deficiency, hematoma, local infections, etc. In the treatment of wounds, many medicinal plants and other herbal immunomodulators are considered useful. Through different pathways, these herbal ointments promote healing and regeneration of the lost tissues without producing side effects.

show abstract

Antibacterial activity of Garlic, Tulsi, Bitter guard and Cinnamon extracts against wound pathogens

Cited by 6 publications

References 0 publications

Synergic antibacterial activity of honey-garlic versus honey-ginger on Pseudomonas aeruginosa and Klebsiella pneumoniae isolated from acute wound infection in Guyana, South America

Synergic antibacterial activity of honey-garlic versus honey-ginger on Pseudomonas aeruginosa and Klebsiella pneumoniae isolated from acute wound infection in Guyana, South America

Molecular characterization of apple endophytic bacteria and biological effect on Alternaria rot on apple

Medicinal Plants: An Insight into Wound Healing

Contact Info

Product

Resources

About