Antimicrobial peptide GH12 suppresses cariogenic virulence factors of Streptococcus mutans

Abstract

Cariogenic virulence factors of Streptococcus mutans include acidogenicity, aciduricity, and extracellular polysaccharides (EPS) synthesis. The de novo designed antimicrobial peptide GH12 has shown bactericidal effects on S. mutans, but its interaction with virulence and regulatory systems of S. mutans remains to be elucidated. The objectives were to investigate the effects of GH12 on virulence factors of S. mutans, and further explore the function mechanisms at enzymatic and transcriptional levels. To avoid decrease in bacterial viability, we limited GH12 to subinhibitory levels. We evaluated effects of GH12 on acidogenicity of S. mutans by pH drop, lactic acid measurement and lactate dehydrogenase (LDH) assay, on aciduricity through survival rate at pH 5.0 and F1F0-ATPase assay, and on EPS synthesis using quantitative measurement, morphology observation, vertical distribution analyses and biomass calculation. Afterwards, we conducted quantitative real-time PCR to acquire the expression profile of related genes. GH12 at 1/2 MIC (4 mg/L) inhibited acid production, survival rate, EPS synthesis, and biofilm formation. The enzymatic activity of LDH and F1F0-ATPase was inhibited, and ldh, gtfBCD, vicR, liaR, and comDE genes were significantly downregulated. In conclusion, GH12 inhibited virulence factors of S. mutans, through reducing the activity of related enzymes, downregulating virulence genes, and inactivating specific regulatory systems.

Antimicrobial peptide GH12 targetsStreptococcus mutansto arrest caries development in rats

“…In our previous studies, the antimicrobial peptide GH12 showed rapidly acting antibacterial efficacy against S. mutans by inducing lysis and pore formation in the cytomembrane [20]. In addition, the virulence factors of this principle caries pathogen were also suppressed [21]. In the current article, aimed at promoting the clinical effect of GH12, its anticaries efficacy was assessed in a well-established rat model, and the observed effect was further supported through in vitro S. mutans biofilm assays.…”

“…The quantitative real-time PCR was performed using a CFX96 Real-Time System (C1000™ Thermal Cycler; Bio-Rad, Hercules, CA). In brief, 25 µL of the mixture containing 12.5 µL of SYBR® Premix Ex Taq ™ II (RR820A; Takara Bio, Shiga, Japan), 1 µL of specific forward primer (10 µM), 1 µL of specific reverse primer (10 µM), 1 µL of the template, and 9.5 µL of double distilled water were placed in each well with the same cycle conditions as used in a previous study [21]. The bacterial counts were determined from standard curves and the results were displayed as lg (cells/mL).…”

“…To combat dental caries, a cationic amphipathic α-helical AMP named GH12 was designed and synthesized de novo and confirmed to show negligible effects on human gingival fibroblasts, good stability in human saliva and excellent antimicrobial properties [19][20][21]. GH12 has rapid bactericidal action with a minimal inhibitory concentration (MIC) and minimal bactericidal inhibitory concentration (MBC) of 8 mg/L against S. mutans.…”

“…In addition, GH12 is able to inhibit biofilm formation by S. mutans and to kill S. mutans in a preformed biofilm [19]. Moreover, GH12 at 4 mg/L restrained the cariogenic properties of S. mutans by reducing bacterial acidogenicity, compromising the aciduricity, inhibiting EPS synthesis to prevent biofilm formation and attenuating the bacterial response to environmental stresses at the enzymatic and transcriptional levels [21].…”

Effects of the natural compound, oxyresveratrol, on the growth of Streptococcus mutans, and on biofilm formation, acid production, and virulence gene expression

“…Forward primer Reverse primer 16S rRNA [28] AGCGTTGTCCGGATTTATTG CTACGCATTTCACCGCTACA Ldh [28] AAAAACCAGGCGAAACTCGC CTGAACGCGCATCAACATCA atpD [28] TGTTGATGGTCTGGGTGAAA TTTGACGGTCTCCGATAACC gtfB [29] TACACTTTCGGGTGGCTTGG AGAAGCTGTTTCCCCAACAGT gtfC [29] AGCAGATTCAACTGACGACCG TCAGTAACAGTGGCGGTTGG gtfD [29] TGCAAGCGACGGAAAACAAG GCCTGTCAGAGCTTCACCAT vicR [28] CGTGTAAAAGCGCATCTTCG AATGTTCACGCGTCATCACC liaR [28] CATGAAGATTTAACAGCGCG CGTCCTGTGGCACTAAATGA comD [28] TTCCTGCAAACTCGATCATATAGG TGCCAGTTCTGACTTGTTTAGGC comE [28] TTCCTCTGATTGACCATTCTTCTG GAGTTTATGCCCCTCACTTTTCAG expression (which was variable), as the concentration of oxyresveratrol also increased. In brief, the expression of glucosyltransferase S (gtfD) and lactate dehydrogenase (ldh) increased at lower concentrations of oxyresveratrol (62.5 and 125 lg ml À1 ) and then showed a slight decrease at the high concentration of oxyresveratrol (250 lg ml À1 ), which was still higher than the control.…”