Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules

Olsen, Christopher M.; Shikiya, Ronald A.; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E.; Marky, Luis A.

doi:10.1016/j.bbagen.2015.10.002

Cited by 15 publications

(25 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…At pH 5.2, Control Tri also has an overall uptake of counterions during folding. However, the uptake is very small compared to duplex DNA[87, 98] and triplexes consisting of TAT base-triplets[72, 73] but is consistent with the values from triplexes containing C + GC base-triplets. [73, 99] This is attributed to the presence of protonated cytosines, which excludes counterions from the phosphate backbone.…”

Section: Resultssupporting

confidence: 61%

“…The following equations were used to measure the thermodynamic uptake of protons, Δ n H +, counterions, Δ n Na +, and water molecules, Δ n W , upon folding of each triplex and control duplexes: [86, 87] normalΔnH+=0.434[normalΔHcal/normalRTnormalM2](∂TM/∂pH) normalΔnNa+=−1.11[normalΔHcal/normalRTnormalM2](∂TM/∂0.2emln[Na+]) normalΔnW=−[normalΔHcal/normalRTnormalM2](∂TM/∂0.2emln[normalanormalW])where 0.434 and 1.11 are correction factors that correspond to conversion of decimal logarithms into natural logarithms and concentrations into ionic activities, respectively. The [Δ H cal /R T M 2 ] term is a constant that is determined from DSC experiments where the enthalpy is model independent and R is the gas constant.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Effect of dC → d(m5C) substitutions on the folding of intramolecular triplexes with mixed TAT and C+GC base triplets

et al. 2018

Self Cite

View full text Add to dashboard Cite

Oligonucleotide-directed triple helix formation has been recognized as a potential tool for targeting genes with high specificity. Cystosine methylation in the 5' position is both ubiquitous and a stable regulatory modification, which could potentially stabilize triple helix formation. In this work, we have used a combination of calorimetric and spectroscopic techniques to study the intramolecular unfolding of four triplexes and two duplexes. We used the following triplex control sequence, named Control Tri, d(AGAGACTCTCTCTCTCT), where C are loops of five cytosines. From this sequence, we studied three other sequences with dC → d(mC) substitutions on the Hoogsteen strand (2MeH), Crick strand (2MeC) and both strands (4MeHC). Calorimetric studies determined that methylation does increase the thermal and enthalpic stability, leading to an overall favorable free energy, and that this increased stability is cumulative, i.e. methylation on both the Hoogsteen and Crick strands yields the largest favorable free energy. The differential uptake of protons, counterions and water was determined. It was found that methylation increases cytosine protonation by shifting the apparent pK value to a higher pH; this increase in proton uptake coincides with a release of counterions during folding of the triplex, likely due to repulsion from the increased positive charge from the protonated cytosines. The immobilization of water was not affected for triplexes with methylated cytosines on their Hoogsteen or Crick strands, but was seen for the triplex where both strands are methylated. This may be due to the alignment in the major groove of the methyl groups on the cytosines with the methyl groups on the thymines which causes an increase in structural water along the spine of the triplex.

show abstract

Section: Resultssupporting

confidence: 61%

Section: Methodsmentioning

confidence: 99%

Effect of dC → d(m5C) substitutions on the folding of intramolecular triplexes with mixed TAT and C+GC base triplets

et al. 2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…The average DH cal /RT M 2 term was obtained from analysis of DSC thermograms at several ethylene glycol concentrations. The unfolding of each oligonucleotide is accompanied by a release of water molecules due to a shift in the equilibrium toward a conformation that has a lower hydration state (55,67). The calculated Dn W values are shown in Table 2 and Fig.…”

Section: Cytosine Bulges Cause a Decrease In The Amount Of Immobilized Water Moleculesmentioning

confidence: 99%

Increased Flexibility between Stems of Intramolecular Three-Way Junctions by the Insertion of Bulges

Carr

Marky

2018

Biophysical Journal

Self Cite

View full text Add to dashboard Cite

Intramolecular junctions are a ubiquitous structure within DNA and RNA; three-way junctions in particular have high strain around the junction because of the lack of flexibility, preventing the junctions from adopting conformations that would allow for optimal folding. In this work, we used a combination of calorimetric and spectroscopic techniques to study the unfolding of four intramolecular three-way junctions. The control three-way junction, 3H, has the sequence d(GAAATTGCGCTGCGCGTGCTGCACAATTTC), which has three arms of different sequences. We studied three other three-way junctions in which one (2HSH), two (HS2HS), and three (HSHSHS) cytosine bulges were placed at the junction to allow the arms to adopt a wider range of conformations that may potentially relieve strain. Through calorimetric studies, it was concluded that bulges produce only minor effects on the enthalpic and thermal stability at physiological salt concentrations for 2HSH and HSHSHS. HS2HS displays the strongest effect, with the GTGC stem lacking a defined transition. In addition to unfolding thermodynamics, the differential binding of counterions, water, and protons was determined. It was found that with each bulge, there was a large increase in the binding of counterions; this correlated with a decrease in the immobilization of structural water molecules. The increase in counterion uptake upon folding likely displaces binding of structural water, which is measured by the osmotic stress method, in favor of electrostricted waters. The cytosine bulges do not affect the binding of protons; this finding indicates that the bulges are not forming base-triplet stacks. These results indicate that bulges in junctions do not affect the unfolding profile or the enthalpy of oligonucleotides but do affect the number and amount of molecules immobilized by the junction.

show abstract

“…Overall, the favorable folding of each pseudoknot, negative ΔG°, took place through the typical favorable enthalpy-unfavorable entropy compensation. Favorable enthalpy contributions correspond to the energy gained by the formation of base pairs and base pair stacking interactions, while unfavorable entropy contributions correspond to the higher ordered state of the helical state of each molecule and the putative uptake of ions and water molecules [34][35][36][37]. In 1 M salt concentration, ΔG°s of -11.1 kcal/mol (CG-PsK) and -12.2 kcal/mol (GC-PsK) were obtained, which were driven by favorable folding enthalpies of -86.8 kcal/mol (CG-PsK) and -78.8 kcal/mol (GC-PsK), respectively.…”

Section: Unfolding Thermodynamics Obtained From Differential Scanningmentioning

confidence: 99%

Melting behavior of pseudoknots containing adjacent GC and AT rich domains

Reiling-Steffensmeier¹,

Nordeen²,

Marky³

2017

Bio Chem Comp

Self Cite

View full text Add to dashboard Cite

Background: Z-DNA is very important in transcription when RNA polymerase transcribes and Z-DNA is formed on the 5' end following the polymerase. Pseudoknots have also been found to play important roles in the biology of RNA, such as the expression of genes and in the overall tertiary structure of RNA molecules. Methods: A combination of UV and circular dichroism (CD) spectroscopies and differential scanning calorimetry (DSC) were used to investigate the UV/CD spectral characteristics and the unfolding thermodynamics of two DNA pseudoknots with the following sequences: d(CGCGCGT 5 GAAATTCCGCGCGT 5 GAATTTC) (CG-PsK) and d(GCGCGCT 5 CAAATT-GGCGCGCT 5 CAATTTG) (GC-PsK), where "T 5 " are loops of five thymines., along with, two control self-complementary duplexes, d(CG) 3 (Du-CG) and d(GC) 3 (Du-GC). Results: The UV/DSC melts showed sequential biphasic (CG-PsK) and triphasic (GC-PsK) transitions, with T M s independent of the strand concentration. Their DSC unfolding took place in two independent parts, the unfolding of the AT rich stem followed by the GC rich stem. CG-PsK's thermodynamic profiles under both salt conditions were similar, while the stability and the folding enthalpy were lower in this salt range for GC-PsK. The CD spectrum showed the d(CG) 3 portion of the stem of CG-PsK flips into a left handed helix in high salt conditions that could be affecting the loop/stem interplay, yielding a higher folding enthalpy relative to GC-PsK. Conclusions: Each pseudoknot formed intramolecularly with sequential transitions corresponding to the associated AT and GC rich melting domains. The placement of d(CG) 3 in CG-PsK yielded a CD spectra with a partial transition of the full stem to a left-handed helix. The melting behavior of CG-PsK remained unchanged with the addition of salt, while GC-PsK was greatly affected due to a more constrained right stem of the pseudoknot. The main reasons for these differences was the melting behavior of the AT rich motif, which is explained in terms of a loop/stem interplay within GC-PsK, hydration differences of their dA•dT base pairs, and/or the conversion of CG-PsK to a partial left handed helix. This conversion could be helping to stabilize this pseudoknot allowing the right stem to be less constrained at 5 M NaCl.

show abstract

Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules

Cited by 15 publications

References 42 publications

Effect of dC → d(m5C) substitutions on the folding of intramolecular triplexes with mixed TAT and C+GC base triplets

Effect of dC → d(m5C) substitutions on the folding of intramolecular triplexes with mixed TAT and C+GC base triplets

Increased Flexibility between Stems of Intramolecular Three-Way Junctions by the Insertion of Bulges

Melting behavior of pseudoknots containing adjacent GC and AT rich domains

Contact Info

Product

Resources

About