Assessing the Roles of Endogenous Retrovirus EAV-HP in Avian Leukosis Virus Subgroup J Emergence and Tolerance

Abstract

Avian leukosis virus (ALV) subgroup J is thought to have emerged through a recombination event between an unknown exogenous ALV and the endogenous retrovirus elements designated EAV-HP. All EAV-HP elements identified to date in the chicken genome show large deletions, including that of the entire pol gene. Here we report the identification of four segregating chicken EAV-HP proviruses with complete pol genes, one of which shows exceptionally high sequence identity and a close phylogenetic relationship with ALV-J with respect to the env gene. Embryonic expression of EAV-HP env has been suggested as a factor associated with immunological tolerance induction in a proportion of ALV-J-infected meat-type chickens. In support of this, env gene transcripts expressed from two of the four newly identified EAV-HP proviruses were demonstrated in chicken embryos. However, when ALV-J-infected outbred meat-type chickens were assessed, the presence of intact EAV-HP proviruses failed to directly correlate with ALV-J tolerance. This association was further examined using F 2 progeny of two inbred lines of layer chicken that differed in EAV-HP status and immunological responses to ALV-J. Immunological tolerance developed in a small proportion of F 2 progeny birds, reflecting the expected phenotypic ratio for inheritance of a double-recessive genotype; however, the status of tolerance did not show any direct correlation with the presence of the intact EAV-HP sequence. Nevertheless, identification of an intact chicken EAV-HP locus showing a uniquely close relationship to the ALV-J prototype clone HPRS-103 in the env region provides the strongest evidence of its contribution to the emergence of ALV-J by recombination.The EAV-HP endogenous retroviruses are members of the ancient endogenous avian retrovirus (EAV) family identified in various species of the genus Gallus. The significance of EAV-HP elements was first recognized following the discovery of elements within the chicken genome with a high degree (Ͼ97%) of sequence identity to the env gene of the avian leukosis virus subgroup J (ALV-J), a new avian pathogen that emerged in the late 1980s (4). ALV-J was identified in the United Kingdom in 1988 as the causative agent of myeloid leukosis, which rapidly became a worldwide health and welfare problem in meat-type chickens (1,21,23,24). The env genes of ALV subgroups A to E are closely related, sharing around 80 to 85% nucleotide sequence identity with each other; the ALV-J env is more distantly related, demonstrating only 40% identity to members of these other subgroups (4). The higher sequence similarity of the ALV-J env to that of EAV-HP suggested that ALV-J emerged as a result of a recombination event between EAV-HP transcripts and genomic RNA of an exogenous ALV (4, 35).EAV-HP elements have a typical provirus structure consisting of 5Ј-long terminal repeat (LTR)-gag-pol-env-LTR-3Ј, and full-length EAV-HP proviruses have been detected in the Sonnerat's or gray jungle fowl (SJF; Gallus sonneratii) (31). In spite of the detection o...

Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl

“…The close genomic proximity (23 bp) of the different insertion sites, observed in Mapuche fowl and Dongxiang chicken, suggests a possible integration site preference for EAV-HP, as has been suggested for several retroviruses [22]. Active ongoing insertion and segregation of EAV-HP in chicken populations have been shown with a typical prevalence of 10 to 15 copies per genome [23], [24]. Such EAV-HP genome dynamism is thought to play a recombinant role in the emergence of exogenous avian retrovirus ALV-J due to a uniquely similar env sequence with the ALV-J prototype HPRS-103 [23].…”

New Simian β Retroviruses from Rhesus Monkeys (Macaca Mulatta) and Langurs (Semnopithecus Entellus) from Rajasthan, India

“…However, there are several reports on replication competent endogenous feline and murine retroviruses [21,22]. Similarly recombinations between endogenous and exogenous retroviruses have been reported in the feline, porcine and avian retroviruses [23][24][25]. Recombination events have also been reported in primate endogenous retrovirus from baboons (BaEV).…”

Çin’de Ekonomik Öneme Sahip Tavukçuluk İşletmelerinde Endojen Retrovirüs Elemanlarının Genomik Analizi

“…The sequencing primer pair for the ART-CHs was derived from the ART-CH gag-related sequences since the ART-CH internal regions were completely defective. [2,22] ART-CH gag-related region F:ctcaaggtggctcatttaac R:acaaagcatggaagacaga 46 657 [2] ev loci env F:ggatgaggtgactaagaaag R:tttgactgtctgcacatctc 48.5 881 [2,18] F:caatcctttctttaacagcg R:taacggaccaacaggctagt 46.5 713 [2] ev/J env F:acaccattggtggcgcgtgtc R:cccgtcacatcgcgttc 48.5 1480 [9] Intact gene F:ttcgtgattggaggaaacacttg R:gttacacttggcacacaaaggtggcataac 60 3900 [9] pol F:ttcgtgattggaggaaacacttg R:cacgtttcctggttgttg 50 568 [15] F: forward primer, R: reverse primer AY013303 AY013304 AY013305 KR188998 KR188999 KR189000 KR189001 KR189002 KR189003 KR189004 KR189005 KR189006 KR189007 E/EAV EAV-0 E51 EAV-BF EAV-GS EAV-LB EAV-LS EAV-PD EAV-RB EAV-SG EAV-SQ EAV-TH EAV-WL X59844 M95189 KR188988 KR188989 KR188990 KR188991 KR188992 KR188993 KR188994 KR188995 KR188996 KR188997 J HPRS-103 Z46390…”

“…Members of the EAV family cannot form an infectious viral particle, but the RT (Reverse Transcriptase) remains functional and has been found in several human live vaccines, such as measles and mumps vaccines as chicken cells are used as a preparation method [14] . Additionally, ART-CH elements consisting of functional LTRs (Long Terminal Repeat) and short regions homologous to the ALV gag, pol, and env sequences can be found in around 50 genomic copies in the chicken genome [15,16] . The gag-related sequences are located within ART-CH elements, the longest of which is the coding sequences for p10, the matrix proteins (MA), and the capsid (CA) [16] .…”