Association Between Serum Insulin Growth Factor-I (IGF-I) and a Simple Sequence Repeat in IGF-I Gene: Implications for Genetic Studies of Bone Mineral Density

Abstract

We recently demonstrated that insulin growth factor-I (IGF-I) cosegregates with bone mineral density (BMD) in progenitor crosses of two inbred strains of mice. Additionally, we reported that men with idiopathic osteoporosis (IOM) have low serum IGF-I levels, which can be related to BMD and bone turnover. In this study, we considered the possibility that serum IGF-I levels are influenced by molecular genetic variation in the IGF-I structural gene, and that a polymorphic microsatellite (CA repeat) in this locus can be used as a genetic marker for such comparisons. We studied 171 men and women, classified according to the trial in which they were participating. First, in 25 Caucasian men with IOM we noted a very high frequency (64%) of homozygosity for the most common allele (192 bp) in a dinucleotide repeat 1 kb upstream from the transcription start site of the IGF-I gene. This compared with a frequency of only 32% in healthy populations (both men and women) (P < 0.004). Next, we determined that for 116 healthy Caucasian men and women the 192/192 genotype was associated with lower serum IGF-I levels than all other genotypes (192/192: 129 +/- 7 ng/mL vs. others: 154 +/- 7 ng/mL, P = 0.03). We also noted that subjects possessing one 194-bp allele exhibited serum IGF-I levels 25% higher than those homozygous for 192 bp (192/192), (P < 0.005) even after correction for age and sex. Similarly, for men with the 192/192 genotype, serum IGF-I concentrations were lower than any other genotype (145 +/- 10 ng/mL vs. 183 +/- 9 ng/ml P < 0.02). In conclusion, low serum IGF-I levels found in men with IOM are associated with homozygosity for a specific allele of the IGF-I microsatellite (192/192), and individual variation in serum IGF-I levels is influenced by genetic factors and may be specifically influenced by variation at the IGF-I structural locus. Further family and pedigree studies are needed to characterize the relationship of bone mass acquisition to the IGF-I genotype.

Insulin-like growth factor-1 (IGF1) genotype predicts breast volume after pregnancy and hormonal contraception and is associated with circulating IGF-1 levels: implications for risk of early-onset breast cancer in young women from hereditary breast cancer families

“…Twin studies (Kao et al, 1994;Harrela et al, 1996) have shown that about 50% of the inter-individual variability in circulating IGF-1 levels is genetically determined. The IGF1 polymorphism is located in the promoter region of the IGF1 gene (Rosen et al, 1998). This microsatellite polymorphism is located one kilobase upstream from the IGF1 transcription start site (Rotwein et al, 1986;Weber and May, 1989) and contains specific regulatory elements (McCarthy et al, 1997).…”

“…The promoter region of the IGF1 gene contains a CA-repeat sequence, which ranges from 12 to 23 repeats (Rosen et al, 1998). Most white women have at least one copy of the 19-repeat allele (Jernström et al, 2001b), but the frequency of the 19-repeat allele varies between ethnic groups (Jernström et al, 2001a).…”

IGF1 genotype, mean plasma level and breast cancer risk in the Hawaii/Los Angeles multiethnic cohort

“…We performed PCR amplification of the DNA region surrounding the microsatellite repeat in question using identical primers to those used in the study by Rosen et al (1998). Their sequences were as follows 5 0 GCTAGCCAGCTGGTGGTGTTATT3 0 and 3 0 ACCACTCTGGGAGAAGGGTA5 0 .…”

“…We extracted DNA from the buffy coats of peripheral blood samples using the Puregene genomic DNA isolation kit (Gentra Systems, Minneapolis, MN, USA). We used a modified genotyping protocol as described by Rosen et al (1998). A total of 20 ng of DNA template, 1.25 pmols of each primer, 0.25 mM of each deoxynucleotide triphosphate, 2.5 mM MgCl 2 , 2% dimethyl sulphoxide, 1.5 U Taq polymerase (Promega, Madison, WI, USA) and the manufacturer's recommended buffers were combined in 25 ml reactions.…”

Absence of the common IGF1 19 CA-repeat allele is more common among BRCA1 mutation carriers than among non-carriers from BRCA1 families

“…The IGF1 gene contains a dinucleotide cytosine-adenine (CA) repeat in the proximity of the promoter, 1kb upstream from the transcription start site (Weber & May, 1989). The CA repeat sequence ranges from 11 to 24 repeats (Rosen et al, 1998;Schildkraut et al, 2005).…”