Association of New Mutant Allele, w4‐nw, at W4 Locus with Near‐White Flower Color in Soybean

Abstract

An ethyl methanesulfonate‐induced mutant (PE1033) with near‐white flowers was isolated from the soybean [Glycine max (L.) Merr.] cultivar Pungsannamul with purple flowers that had the W1w3W4 genotype. In the present study, we aimed to investigate the genetic and molecular bases of the flower color variation displayed by the PE1033 mutant. Analyses of genomic sequences and reverse transcription–polymerase chain reaction (RT‐PCR) revealed that the color variation of PE1033 flowers originated from a recessive mutation in the W4 locus that encodes dihydroflavonol 4‐reductase (DFR) 2. The new mutant allele, named w4‐nw, harbored a single‐nucleotide substitution (G to A) at the 5′ spliceosome recognition site in the first intron of DFR2, resulting in the failure of splicing and producing two different abnormal transcripts: w4‐nw‐a and w4‐nw‐b. The former encoded a truncated DFR2 protein because of the occurrence of a premature stop codon in the first intron, which was retained in the transcript; the latter resulted from alternative splicing of the first intron and encoded a DFR2 protein that lacked 11 amino acid residues in the N‐terminus. Derived cleaved amplified polymorphism sequence (dCAPS) analysis revealed a tight cosegregation pattern between the w4‐nw mutant allele and near‐white color phenotype. In conclusion, the novel mutation in the W4 locus, w4‐nw, caused the production of near‐white flowers under the w3 allelic background of PE1033.

Molecular Genetic Analysis of a Novel Recessive White Flower Gene in Wild Soybean

“…(C) The tree constructed using genome sequences ranging from the primer sequence ACTTGATTTCAGCCATGGTA to stop codon of DFR2. Most of w4 mutants investigated were derived from ethyl methanesulfonate-treated populations or revertant mutants from T322 containing an active CACTA-like transposable element, except for cultivar Laredo (Hartwig and Hinson, 1962;Palmer et al, 1989;Xu et al, 2010;Yan et al, 2014;Park et al, 2016). Genbank accession numbers of DFR2 sequences retrieved from GenBank are KU376490 (Pungsannamul), AB872216 (Clark), KX077985 (CW12700), KX077986 (IT182932), and AB872217 (kw4).…”

“…Although flower colors were predominantly determined by the W1 locus in the current G. max population, numerous studies have shown that mutations at the W4 locus were responsible for changes in flower colors, ranging from dilute purple to near white. Most of w4 mutants investigated were derived from ethyl methanesulfonate-treated populations or revertant mutants from T322 containing an active CACTA-like transposable element, except for cultivar Laredo (Hartwig and Hinson, 1962;Palmer et al, 1989;Xu et al, 2010;Yan et al, 2014;Park et al, 2016). Mutation at the w4 locus in Laredo appeared to be stable because a single-nucleotide substitution abolished the 5¢ splice site of the fourth intron, resulting in the expression of a truncated polypeptide.…”

Identification and Molecular Analysis of Four New Alleles at the W1 Locus Associated with Flower Color in Soybean

“…In soybean, DFR-encoding genes co-segregated with two genetic loci, namely, W3 ( DFR1 ) and W4 ( DFR2 ), and they were epistatic to each other under the W1 allelic background [ 10 , 11 ]. Double mutations in W3 and W4 , i.e., w3 w4 , led to the development of near-white flowers in soybean [ 11 , 23 , 24 ].…”

Color Variation in a Novel Glycine soja Mutant W4‐S1 with Pinkish‐White Flowers Is Controlled by a Single Recessive Allele at the W4 Locus

“…These authors found that DFR1 is highly expressed in a W3 allelic background but is barely expressed in w3 and also proposed that, among several polymorphisms detected in the genomic sequence of the w3 allele, a noteworthy insertion and deletion (indel) of 311 bp in the 5′‐upstream region might cause the disruption of DFR1 expression. With respect to the W4 locus in the w3 recessive allelic background, six different mutant alleles have been reported, namely, w4 , w4‐m , w4‐dp , w4‐p , w4‐lp , and w4‐nw , which produce near‐white, variegated, dilute purple, pale purple, light purple, and near‐white flowers, respectively (Palmer et al, 1989; Groose and Palmer, 1991; Xu and Palmer, 2005; Xu et al, 2010; Yan et al, 2014; Park et al, 2016).…”

“…To date, only six accessions have been reported to have white or white‐hued flowers. Genetic and molecular studies have revealed that flower color in five of these six accessions is related to mutations at the W1 locus (Chen and Nelson, 2004; Takahashi et al, 2010, 2012; Park et al, 2016). In addition, Yan et al (2014) showed that the near‐white color of the G. soja accession kw4 is controlled by a recessive allele of the W4 locus, which encodes DFR2.…”