Autocrine/paracrine pattern of superoxide production through NAD(P)H oxidase in coronary arterial myocytes

Abstract

The present study tested the hypothesis that membrane-bound NAD(P)H oxidase in coronary arterial myocytes (CAMs) is capable of producing superoxide (O(2)(*-)) toward extracellular space to exert an autocrine- or paracrine-like action in these cells. Using a high-speed wavelength-switching fluorescent microscopic imaging technique, we simultaneously monitored the binding of dihydroethidium-oxidizing product to exogenous salmon testes DNA trapped outside CAMs and to nuclear DNA as indicators of extra- and intracellular O(2)(*-) production. It was found that a muscarinic agonist oxotremorine (OXO; 80 microM) increased O(2)(*-) levels more rapidly outside than inside CAMs. In the presence of superoxide dismutase (500 U/ml) plus catalase (400 U/ml) and NAD(P)H oxidase inhibitor diphenylene iodonium (50 microM) or apocynin (100 microM), these increases in extra- and intracellular O(2)(*-) levels were substantially abolished or attenuated. The O(2)(*-) increase outside CAMs was also confirmed by detecting oxidation of nitro blue tetrazolium and confocal microscopic localization of Matrigel-trapped OxyBURST H(2)HFF Green BSA staining around these cells. By electron spin resonance spectrometry, the extracellular accumulation of O(2)(*-) was demonstrated as a superoxide dismutase-sensitive component outside CAMs. Furthermore, RNA interference of NAD(P)H oxidase subunits Nox1 or p47 markedly blocked OXO-induced increases in both extra- and intracellular O(2)(*-) levels, whereas small inhibitory RNA of Nox4 only attenuated intracellular O(2)(*-) accumulation. These results suggest that Nox1 represents a major NAD(P)H oxidase isoform responsible for extracellular O(2)(*-) production. This rapid extracellular production of O(2)(*-) seems to be unique to OXO-induced M(1)-receptor activation, since ANG II-induced intra- and extracellular O(2)(*-) increases in parallel. It is concluded that the outward production of O(2)(*-) via NAD(P)H oxidase in CAMs may represent an important producing pattern for its autocrine or paracrine actions.

Local production of O2− by NAD(P)H oxidase in the sarcoplasmic reticulum of coronary arterial myocytes: cADPR-mediated Ca2+ regulation

“…Intracellular ROS production around the SR was monitored by their trapping with 5-(and-6)-chloromethyl-2′, 7′-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H 2 DCFDA) and simultaneous labeling of the SR by ER-Tracker ™ red dye using confocal laser scanning microscopy [7]. Subconfluent CAMs plated on the Φ35mm cell culture plates were washed for three times with Hanks' buffered saline solution (HBSS) that contains (in mM): 137 NaCl, 5.4 KCl, 4.2 NaHCO 3 , 3 Na 2 HPO 4 , 0.4 KH 2 PO 4 , 1.5 CaCl 2 , 0.5 MgCl 2 , 0.8 MgSO 4 , 10 glucose, 10 HEPES (pH 7.4), then incubated at 37°C with 5% CO 2 in the same HBSS buffer containing 1 μM ER-Tracker ™ red dye for 15min, followed by adding ROS detection agent CM-H 2 DCFDA to a final concentration of 1 μM and continuing to incubate for another 15 min.…”

“…The most effective pair of siRNA for targeting CD38 (NM_175798) consisted of AAGCGATCAGGCAGGCATTCA and its countpartner; for RyR2 (XM_617538) was AACTGCCAGAGCCAGTAAAAT; and for Nox4 (XM_614713) was AAGACCTGGCCAGTATATATTAT. siRNA transfection was performed according to the manufacturer's instruction in Qiagen TransMessenger kit and as we described previously [7].…”

“…Purified SR from bovine coronary artery was suspended in modified Kreb's_HEPEs buffer containing deferoximine (100μM) [7,21]. The NOX activity to produce O 2 .− in the SR was examined by addition of 1 mM NADH as a substrate in the 100 μg purified SR mixture and incubated for 15 min, and then supplied with 1 mM O 2 .− -specific spin trap 1-hydroxy-3-methoxycarbonyl-2,2,5,5-tetramethylpyrrolidine(CMH) in the presence or absence of NOX inhibitors apocynin (Apo, 100 μM) or SOD (200 U/ml) or its mimetic Tiron (1 mM).…”

“…However, the topologic analysis has indicated that membrane-associated NOX should not release O 2 .− into cytosol [5]. Recent studies on subcellular localization of vascular NOX have also demonstrated that O 2 .− within VSMCs may not be derived from plasma membrane NOX (mNOX), but rather from intracellular compartmental NOXs [3,6,7]. We have recently reported that mNOX in VSMCs produced O 2 .− in autocrine or paracrine producing manner when the cells were exposed to different agonists [7].…”

“…Recent studies on subcellular localization of vascular NOX have also demonstrated that O 2 .− within VSMCs may not be derived from plasma membrane NOX (mNOX), but rather from intracellular compartmental NOXs [3,6,7]. We have recently reported that mNOX in VSMCs produced O 2 .− in autocrine or paracrine producing manner when the cells were exposed to different agonists [7]. Using purified sarcoplasmic reticulum (SR) from coronary arterial myocytes (CAMs), we also demonstrated that an NOX is present on the SR, and this oxidase locally activates the cyclic ADP -ribose (cADPR) -sensitive ryanodine receptors/Ca 2+ (RyR/ Ca 2+ ) release channels [3].…”