Bacterial Diversity Under Different Tillage and Crop Rotation Systems in an Oxisol of Southern Brazil

Abstract

Microbial diversity can be used to assess the impact of agricultural practices on the long-term sustainability of cropping systems. The aim of this study was to investigate changes in soil bacterial diversity as a result of the impact of different soil tillage and crop rotation systems in an oxisol of southern Brazil. Bacterial diversity was examined in the 0-10 cm layer in two field experiments by analyzing soil DNA using 16S rDNA-DGGE profiles. Experiment one consisted of a long-term 26-year trial with four soil tillage management systems: (1) no-tillage (NT), (2) disc plow (DP), (3) field cultivator (FC), and (4) heavy-disc harrow (DH), all under soybean (summer)/wheat (winter) crop succession. Experiment two consisted of a short-term 10-year trial with DP and NT and three crop rotations (CR) including grasses, legumes and green manures. Cluster analysis of the 16S rDNA sequences revealed that the main effect on clustering was attributed to differences in soil tillage management systems. The Shannon index confirmed greater bacterial diversity under NT, followed by the FC, DH and DP. Therefore, diversity decreased as tillage practices intensified. The evenness index demonstrated uniformity of the profiles of the bacterial communities, with dominance of a few communities, regardless of soil tillage and crop rotation. Different crop rotations had only minor effects on bacterial diversity, what could be related to a previous fallow period. The results suggest that bacterial diversity analyzed by DGGE may be useful as bioindicator of the changes caused by soil tillage.

Effects of different soil management practices on soil properties and microbial diversity

“…These findings are consistent with those reported by Mathew et al (2012) and Peixoto et al (2006). Moreover, Silva et al (2013) reported that in a long-term field experiment, the DNA profiles representative of each tillage treatment showed differences in soil bacterial diversity, with greater diversity under NT, compared to the other systems studied, inter alia CT. The dendrogram derived from the 16S rDNA DGGE profiles also revealed the effect of tillage system choice on the overall bacterial community structure in different depths of soil profile (Fig.…”

“…8). Soil under systems with lower soil disturbance such as the NT system could also protect microbial habitats by increasing the soil organic matter concentration, enhancing soil moisture content and decreasing temperature variations, all of which affect soil microbial diversity (Silva et al, 2013). Moreno et al (2009) Explanations as in Fig.…”

Effects of Conservation Agriculture and Fertilization on Soil Microbial Diversity and Activity

“…Although not significantly, microbial species under NT were slightly more abundant within the microbial community, i.e., lower dominance, compared to microbial species under CT (Figure 6b). This slightly higher level of dominance of certain soil microbial species found in microbial communities under CT could be attributed to the disruption of microbial development and establishment due to tillage [50]. This would typically cause the strongest and more adaptable microorganisms to establish and flourish first.…”

LONG-TERM EFFECTS OF SWINE wastewater AND MINERAL FERTILIZER ASSOCIATION ON SOIL MICROBIOTA

“…The primers used were F-968 (5´CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAACGCGAAGAACCTT AC-3), with the GC clamp and R-1401 5´-GCGTGTGTACAAGACCC-3) (NŪBEL et al, 1996). The amplification reaction was carried out according to SILVA et al (2013). Gels were stained with ethidium bromide (0.3 μg m L -1 ) and visualized with UV light.…”