Benign Migratory Glossitis

Khan, Sarfaraz; Mujahid, Tanveer Ahmed; Bukhari, Syed; Saeed, Imran

doi:10.29271/jcpsp.2018.02.175

Cited by 7 publications

(8 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Contrary to the present study's findings, [4] Microscopy recorded a sensitivity value of 85.71% in the present study. This is similar to the findings of [33], who reported a sensitivity value of 89.4 but with higher specificity and positive and negative predictive values of 100% each. In addition, the findings from this study also contradict the results of [34]…”

Section: Figure 3 -Malaria Prevalence Using Microscopy and Pcrsupporting

confidence: 90%

Comparative Analysis of the Effectiveness of Polymerase Chain Reaction and Microscopy in Malaria Diagnosis

Muhammad

Mohammed

Usman³

et al. 2023

PoS

View full text Add to dashboard Cite

Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5'AACAGACGGGTAGTCATGATTGAG3' R5'GTATCTGATCGTCTTCACTCCC3'. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy.

show abstract

Section: Figure 3 -Malaria Prevalence Using Microscopy and Pcrsupporting

confidence: 90%

Comparative Analysis of the Effectiveness of Polymerase Chain Reaction and Microscopy in Malaria Diagnosis

Muhammad

Mohammed

Usman³

et al. 2023

PoS

View full text Add to dashboard Cite

show abstract

“…Given the importance of metastatic status in prognostication of Ewing sarcoma, traditional staging includes imaging via chest CT, whole-body bone scan, and often PET-CT scan [1,2,9]. The proportion of bone marrow involvement in Ewing sarcoma has been estimated to be between 5% to 10% [8,11]. For this reason, the National Comprehensive Cancer Network guidelines for Ewing sarcoma include consideration of bone marrow aspiration and biopsy (BMAB) for the assessment of metastatic disease [4].…”

Section: Introductionmentioning

confidence: 99%

Is Bone Marrow Aspiration and Biopsy of Clinical Importance in the Initial Staging of Extraskeletal Ewing Sarcoma?

Wahlig

Broida

Rose

et al. 2023

Clin Orthop Relat Res

View full text Add to dashboard Cite

Background Extraskeletal Ewing sarcoma are rare tumors within the Ewing sarcoma family. Initial staging studies for extraskeletal Ewing sarcoma historically have included imaging and bone marrow aspiration and biopsy (BMAB). However, recent studies on Ewing sarcoma of bone have questioned the utility of BMAB in the initial staging of patients, but no studies of which we are aware have evaluated the role of BMAB in extraskeletal Ewing sarcoma. We suspected that BMAB was of low diagnostic yield in patients with extraskeletal Ewing sarcoma and exposed patients to potential morbidity without an impact on their clinical course. Question/purpose Is BMAB a useful test in the staging of extraskeletal Ewing sarcoma? Methods Between January 1996 and December 2021, our institution evaluated 109 patients with a listed diagnosis of extraskeletal Ewing sarcoma. Those patients were retrospectively reviewed for this study. Of those, we considered patients with biopsy-confirmed diagnosis of extraskeletal Ewing sarcoma. Biopsy was performed based on institutional protocols, with all diagnoses assigned by a board-certified pathologist. Based on that criteria, 96% (105 of 109) were eligible. An additional 18% (20 of 109) were excluded because records of their initial diagnostic and staging workup were not available. This left 78% (85 of 109) for analysis. Of those, 52% (44 of 85) were male. The average age was 32 ± 16 years. Primary tumor locations included extremities in 26% (22 of 85), paraspinal in 20% (17 of 85), chest in 19% (16 of 85), retroperitoneum in 13% (11 of 85), intraabdominal in 12% (10 of 85), intrapelvic in 7% (6 of 85), and head or neck in 4% (3 of 85). Initial diagnostic and staging information, including the use of PET-CT, bone scan, CT chest, and BMAB, was collected. Metastatic disease at the time of presentation or during follow-up was noted. The utility of BMAB was determined by the rate of positive tests in those undergoing BMAB during the initial staging process. Descriptive statistical analysis was sufficient to address the study question, and therefore no comparative statistics were performed. Results BMAB was obtained during the initial staging process in 64% (54 of 85) of patients. This BMAB was negative in all 54 patients, including those with known metastatic disease. Conclusion Diagnosing metastatic disease in extraskeletal Ewing sarcoma is important as the presence of metastases at diagnosis adversely affects prognosis. The routine use of BMAB in the staging process of extraskeletal Ewing sarcoma is of low diagnostic yield. BMAB is unlikely to diagnose metastatic involvement even in patients with known metastases to bone. We do not have enough data to suggest whether other modalities, such as PET-CT, might be more useful. Similar studies should be pursued to determine the utility of the remainder of staging modalities in patients with extraskeletal Ewing sarcoma to elucidate the most efficient and effective staging protocol. Level of Evidence Level III, diagnostic study

show abstract

“…In treatment, topical corticosteroids may be recommended for symptomatic relief (Jacob, 2016;Khan, 2018).It was determined that the 55-year-old female patient, who was diagnosed polymyositis and prescribed systemic corticosteroids and azathioprine, started at the same time, applied to our clinic with the complaints of centralized, peripheral hyperkeratotic white plaques that give a feeling of burning against widespread, erythematic, hot, and acidic food. The disease causes pain and burning sensation in patients particularly when they intake acidic and hot food.…”

mentioning

confidence: 99%

“…In treatment, topical corticosteroids may be recommended for symptomatic relief (Jacob, 2016;Khan, 2018). In treatment, topical corticosteroids may be recommended for symptomatic relief (Jacob, 2016;Khan, 2018).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Geographic tongue that responds to the treatment of pregabalin: Can it be a new treatment choice?

Kurtipek

Sarı

Akyürek

2018

Dermatologic Therapy

View full text Add to dashboard Cite

Geographical tongue, also known as benign migratory glossitis or erythema migrans, is a benign dermatosis whose specific etiology is not known due to the disappearance of central erythematous and filiform papillaries surrounded by a hyperkeratotic ring forming the geographical shape on the tongue. The disease causes pain and burning sensation in patients particularly when they intake acidic and hot food.Nutritional deficiencies were rarely encountered in the research. In treatment, topical corticosteroids may be recommended for symptomatic relief (Jacob, 2016;Khan, 2018).It was determined that the 55-year-old female patient, who was diagnosed polymyositis and prescribed systemic corticosteroids and azathioprine, started at the same time, applied to our clinic with the complaints of centralized, peripheral hyperkeratotic white plaques that give a feeling of burning against widespread, erythematic, hot, and acidic food. It did not benefit from the topical treatments that she used from time to time for a long time. In the dermatological examination of the patient, the widespread periphery, starting from the ventral to the dorsal root, surrounded by white hyperkeratotic rings, consisting of plaques characterized by the disappearance of erythematous, filiform papillaries were seen (Figure 1). The nutritional tests of the patient were evaluated as normal. There was emotional stress that due to the role of chronic illness in the patient. Initially 2 × 25 mg pregabalin treatment started. In the first month of the treatment the lesions recovered 80-90%, and burning sensation diminished too (Figure 2). The treatment of the patient was readjusted to 1 × 25 mg/day. In the second month of the treatment, there was no increase in lesions; it was observed that there was some new healing and total regression of the subjective symptoms (Figure 3). Pregabalin, is an analogue of gamma amino butyric acid (GABA). It is the calcium canal ligand of pregabalin α2-δ and it is strongly attached to FIGURE 1 Geographical tongue before treatmentFIGURE 2 The first month of pregabalin treatment FIGURE 3 The second month of pregabalin treatment

show abstract

Benign Migratory Glossitis

Cited by 7 publications

References 0 publications

Comparative Analysis of the Effectiveness of Polymerase Chain Reaction and Microscopy in Malaria Diagnosis

Comparative Analysis of the Effectiveness of Polymerase Chain Reaction and Microscopy in Malaria Diagnosis

Is Bone Marrow Aspiration and Biopsy of Clinical Importance in the Initial Staging of Extraskeletal Ewing Sarcoma?

Geographic tongue that responds to the treatment of pregabalin: Can it be a new treatment choice?

Contact Info

Product

Resources

About