Beyond the double helix: DNA structural diversity and the PDB

Neidle, Stephen

doi:10.1016/j.jbc.2021.100553

Cited by 32 publications

(20 citation statements)

References 107 publications

(99 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The extreme flexibility of a single DNA strand is in marked contrast to the limited range of structures known for the familiar double helical DNA. 1 The flexibility includes both that of the DNA sugar−phosphate backbone and that of the orientation of the DNA bases relative to the sugar rings. Singlestranded DNA is found naturally at the ends of chromosomes, which in humans consists of several hundred repeats of the telomeric base sequence (T 2 AG 3 ) n .…”

Section: ■ Introductionmentioning

confidence: 99%

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex

et al. 2022

View full text Add to dashboard Cite

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

show abstract

Section: ■ Introductionmentioning

confidence: 99%

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex

et al. 2022

View full text Add to dashboard Cite

show abstract

“…In parallel, the combination of the physico-chemical properties of DNA (folding, stability, programmability and self-recognition) with access to all 230 space groups through the use of racemic DNA mixtures may give access to novel materials and/or self-assembled nanostructures. Indeed, beyond the variety of naturally occurring DNA structures (Neidle, 2021), DNA has also been studied extensively as a tool for the construction of precise self-assembled nanomaterials and nano-objects with intriguing properties (Seeman, 2003(Seeman, , 2010Rothemund, 2006;Aldaye et al, 2008;Andersen et al, 2009;McLaughlin et al, 2011). In this vein, here we report two racemic crystal structures of the DNA sequence d(CCCGGG).…”

Section: Introductionmentioning

confidence: 88%

Racemic crystal structures of A-DNA duplexes

Mandal¹,

Collie²,

Kauffmann³

et al. 2022

Acta Crystallogr D Struct Biol

View full text Add to dashboard Cite

The ease with which racemic mixtures crystallize compared with the equivalent chiral systems is routinely taken advantage of to produce crystals of small molecules. However, biological macromolecules such as DNA and proteins are naturally chiral, and thus the limited range of chiral space groups available hampers the crystallization of such molecules. Inspiring work over the past 15 years has shown that racemic mixtures of proteins, which were made possible by impressive advances in protein chemical synthesis, can indeed improve the success rate of protein crystallization experiments. More recently, the racemic crystallization approach was extended to include nucleic acids as a possible aid in the determination of enantiopure DNA crystal structures. Here, findings are reported that suggest that the benefits may extend beyond this. Two racemic crystal structures of the DNA sequence d(CCCGGG) are described which were found to fold into A-form DNA. This form differs from the Z-form DNA conformation adopted by the chiral equivalent in the solid state, suggesting that the use of racemates may also favour the emergence of new conformations. Importantly, the racemic mixture forms interactions in the solid state that differ from the chiral equivalent (including the formation of racemic pseudo-helices), suggesting that the use of racemic DNA mixtures could provide new possibilities for the design of precise self-assembled nanomaterials and nanostructures.

show abstract

“…We know that the helical rate is about 10 base pairs per rotation. Clustering could arise from secondary structure [1,7]. One approach to structural statistics might be to look for correlations between pairs or groups of amino acids separated by specific distances along the helical structure.…”

Section: Am J Biomedmentioning

confidence: 99%

“…In the light of recent structural developments in DNA structural diversity crystallographic studies and the Protein Data Bank [1], this note is intended to draw attention to an interesting feature of the ordering of amino acids along protein chains. They all exhibited clustering compared to a random distribution, so there is a stable long range ordering that is unexpected.…”

Section: Introductionmentioning

confidence: 99%

“…In other words, the frequencies of shorter gap lengths tends to be higher and the variance of the gap lengths is greater than expected by chance. This may be because localizing amino acids with the same properties may favour secondary structure formation or transmembrane domains [1]. The biological significance is yet to be elaborated but it is intriguing to consider the phenomenon as providing a long-range rule that acts as a check during DNA synthesis.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation