BigH3 protein expression as a marker for breast cancer

Abstract

Abstract. The current hypothesis of tumorigenesis in humans suggests that cancer cells acquire their hallmarks of malignancy through the accumulation of advantageous gene activation and inactivation events over long periods of time. For breast cancer development, this multistep process may manifest itself as a sequence of pathologically defined stages. It is widely held that breast cancer originates at the premalignant stage of atypical ductal hyperplasia, progresses to the preinvasive stage of ductal carcinoma in situ, and culminates in the potentially lethal stage of invasive ductal carcinoma. Tumor grade has been a highly valuable prognostic factor for breast cancer, and high-grade ductal carcinoma in situ lesions are associated with poor clinical outcome. The aim of this work was to investigate the BigH3 protein expression changes associated with various stages of breast cancer progression in comparison to benign specimens using tissue microarray technology. Pathological characteristics of breast tissues ranged from benign lesions to breast cancers either of lobular or ductal carcinomas in origin, and included in situ ductal carcinomas, lobular carcinomas, infiltrating ductal carcinomas, carcinomas, scirrhous carcinomas, adenocarcinomas and infiltrating colloid carcinomas. BigH3 protein expression was analyzed by immunohistochemistry in 192 cases of breast tumors. Results indicated a decrease in BigH3 protein expression from benign tissues to in situ ductal carcinoma, lobular carcinoma, infiltrating ductal carcinomas, carcinomas, scirrhous carcinoma, adenocarcinomas to infiltrating colloid carcinomas. We observed that the benign tissue had a 23-fold increase in BigH3 protein expression compared to the infiltrating colloid carcinoma which was the most malignant tissue analyzed. In summary, these studies confirmed the suppressor effect of the BigH3 gene expressed as protein expression in those processes related to the progression of breast tumorigenesis. We conclude that this protein can be used as a marker for breast cancer progression.

Identification and validation of TGFBI as a promising prognosis marker of clear cell renal cell carcinoma

“…TGFBI was upregulated in many human tumors [17][18][19]. Depending on the tissue, TGFBI could be a promoter or a suppressor of cancer growth [20][21][22]. In renal cancer, TGFBI was studied for the first time by Ivanov et al who showed its overexpression in cancer vs. normal renal tissue [23].…”

TGFBI Deficiency Predisposes Mice to Spontaneous Tumor Development

“…The expression of cyclin D1 gene was analyzed by quantitative real-time RT-PCR (Applied Biosystems 7300) using the procedures described previously (14). The primer sets are as following: 5’TCGTGGCCTCTAAGATGAAG3’ and 5’TTTTGGAGAGGAAGTGTTCG for mouse cyclin D1 ; 5’AAGGTCATCCCAGAGCTGAA3’ and 5’CTGCTTCACCACCTTCTTGA 3’ for mouse GAPDH.…”

“…TGFBI product has been shown to be a component of ECM in lung and mediate cell adhesion and migration through interacting with integrin via integrin receptors: α3β1, αvβ3, and αvβ5 (6–10). It is ubiquitously expressed in human normal tissues; however, downregulation or lost expression of this gene has been found in a list of human tumor cell lines including lung, breast, colon, prostate, and leukemia as well as in human primary lung and breast tumor specimens (11–14). CpG island hypermethylation in the promoter region, one of the mechanisms by which tumor suppressor genes are inactivated in human cancers, correlates with the silencing of TGFBI promoter and its subsequent down-expression (15).…”

Targeted Disruption of TGFBI in Mice Reveals Its Role in Regulating Bone Mass and Bone Size through Periosteal Bone Formation

“…Although it is present in a wide range of tissues, TGFBI is highly expressed in bone, cartilage, cornea, kidney, and skin [8,21]. It is an important molecule studied for cancers [8,[22][23][24][25][26][27][28][29][30], corneal dystrophies [8,31,32], and wound healing [15,[33][34][35]. A few in vitro studies related to bone metabolism have found that TGFBI has a positive effect on the adhesion and migration of osteoblasts and a negative effect on the differentiation and mineralization of osteoblasts as well as hypertrophic chondrocytes [17,18,36,37].…”