Biochemical evidence of chromosome homoeology among related plant genera

Abstract

SUMMARYBiochemical markers associated with homoeologous chromosome groups 3 and 7 of Triticum aestivum L. have been investigated in genetic stocks carrying chromosomes or chromosomal segments of the same homoeology groups from Agropyron elongatum and Sécale cereale.Chromosomes 3Ag of Agropyron and 3R of Sécale control proteins a 3 and b 3 with the same properties as proteins 5, 6 and 7 associated with 3B and 3D of Triticum. It is concluded that genes for proteins 5, a 3 and b 3 are located in segments proximal to the centromere in the j3 arms of chromosomes 3D and 3Ag, respectively. Proteins 3, 4 and 11, controlled by 7D-short arm of Triticum, are replaced by proteins a 7 , b 7 and c 7 , when that chromosome is replaced by 7Ag. Genes for these proteins are located proximal to the centromere in the short arms of chromosomes 7D and 7Ag. Finally, a gene that controls sterol esterification is similarly located in the short arms of chromosomes 7D and 7Ag.

Homoeologous chromosomal location of the genes encoding thionins in wheat and rye

“…The present results further illustrate the usefulness of biochemical systems to demónstrate homoeology (ancestral homology) down to the level of chromosomal segments (Rodríguez-Loperena et al 1975;Hart et al 1976;Kobrehel 1978). It should be also pointed out that the thionin system can be used as a marker in the manipulation of chromosome IR, which has been shown to be a source of disease resistance genes.…”

Eyespot resistance gene Pch-1 from Aegilops ventricosa is associated with a different chromosome in wheat line H-93-70 than the resistance factor in “Roazon” wheat

“…Proteins NGE-11 and C-7 were analysed by twodimensional electrophoresis by a modifícation of the method described by Rodriguez-Loperena et al (1975). Shorter gel columns (0.2 x 5.5 cm) and only 2 h of focusing time were used in the first dimensión.…”

“…2, where phenotypes corresponding to the four possible chromosome combinations (AgAgAg; AgAgD; AgDD; DDD) can be discerned on the basis of the presence and relative amounts of proteins NGE-11 (7D marker) and C-7 (7Ag marker), based on the previous observations of Rodriguez-Loperena et al (1975). The F2 half-kernels that carried the embryos were planted and tested for eyespot resistance (Table 2).…”

Cm-Proteins And Thionins In Cereals: Characterization And Cloning Of Cdna

“…The genetic control of CM-proteins has been extensively studied both in wheat and in barley (1)(2)(3)(4)10,(12)(13)(14)(15)(16)22). The chromosomal locations of genes enco_ ding these proteins have been established through the analysis of aneuploid, addition, and substitution Tines.…”

“…The chromosomal locations of genes enco_ ding these proteins have been established through the analysis of aneuploid, addition, and substitution Tines. Genes forthese proteins have been found to be dispersed in chromosomes of groups 3, 4, 6, and 7 of wheat (1,3,10,12,13,22) and in chromosomes 1 (homeologous to group 7 of wheat), 3, and 4 of barley (15). Both cis and trans regulatory effects on the expression of the CM genes have been characterized in wheat (4,14) and, recently, differential effects of leu leu leu ala val leu thr thr val val ala thr ala glu arg asp tyr gly glu tyr TTG TTG CTC GCT GTC CTC ACC ACC GTC GTG GCA ACT GCG GAA CGG GAC TAC GGC GAG TAC cys arg val gly lys ser i le pro i le asn pro leu pro ala cys arg glu tyr i le thr TGC CGC GTG GGG AAG TCG ATT CCC ATC AAC CCT CTC CCC GCT TGC CGA GAG TAC ATC ACG ara arg cys ala val gly asp gln gln val pro asp val leu lys gln gln cys cys arg CGC CGG TGC GCC GTC GGA GAC CAG CAG GTG CCG GAT GTC CTC AAG CAG CAG TGC TGC CGG glu leu ser asp leu pro glu ser cys arg cys asp ala leu ser ile leu val asn gly GAG CTC AGC GAC CTG CCG GAA AGT TGC CGG TGC GAT GCC CTG AGC ATC CTA GTG AAC GGC val ile thr glu asp gly ser arg val gly arg met glu ala val pro arg cys asp gly GTG ATC ACG GAG GAC GGC TCC AGG GTC GGC CGG ATG GAG GCG GTG CCG CGG TGT GAC GGG glu arg ile his ser met gly ser tyr leu thr ala tyr ser glu cys asn pro his asn GAG AGG ATC CAT TCC ATG GGG TCG TAT CTC ACG GCG TAT AGT GAG TGC AAT CCG CAC AAT pro gly thr pro arg gly asp cys val leu phe gly gly gly ile ser ter CCG GGT ACC CCT AGA GGG GAC TGC GTG CTG TTT GGT GGC GGC ATC AGT TAG TTAGCTCTAGG poly A poly A TAGTACTCA'AATAAATGTTGCATGAGTCGATTGTGGTTGTGGTGCATGCATCCGTGGTATACAA'AATAAA'GGATGGAAA GTCT pUP-38 leu pro glu trp met thr ser ala glu leu asn tyr pro gly gln pro tyr leu ala lys TTA CCC GAA TGG ATG ACÁ TCC GCG GAG CTG AAC TAC CCC GGG CAG CCA TAC CTC GCC AAG leu tyr cys cys gln glu leu ala glu ile pro gln gln cys arn cys glu ala leu arg TTG TAT TGT TGC CAÁ GAG CTT GCA GAA ATT CCC CAG CAG TGC CGG TGC GAG GCG CTG CGC thr ser met ala leu pro val pro pro gln pro val asp pro ser thr gly asn val gly ACT TCA ATG GCG TTG CCG GTA CCG CCT CAG CCC GTG GAC CCG AGC ACC GGC AAT GTT GGT gln ser qly leu met asp leu pro gly cys pro arg glu met gln arg asp phe val arg CAG AGC GGC CTC ATG GAC CTG CCC GGA TGC CCC AGG GAG ATG CAÁ CGG GAC TTC GTC AGA leu leu val ala pro gly gln cys asn leu ala thr ile his asn val arg tyr cys pro TTA CTC GTC GCC CCG GGG CAG TGC AAC TTG GCG ACC ATT CAC AAC GTT CGA TAC TGC CCC ala val glu gln pro leu trp ile ter GCC GTG GAA CAG CCG CTG TGG ATC TAG TGATGATAAAATCAGTCGTTCGTGAATAAGCATGCATGTTGCG TACATAGGCGTAGGCGTGTGCGTGTGGTGTGCATGTATGCATATGTGAGCTCCGCACGCTCAACATGTGTGGGCTATCT poly A GCTATGAACGAG'AATAAA'GAGAACCATTTTGTGGTTCTTTAATTTCA 32 with the sequence of barley trypsin inhibitor CMe (19).…”